Incidental Mutation 'R3871:Satb2'
ID276547
Institutional Source Beutler Lab
Gene Symbol Satb2
Ensembl Gene ENSMUSG00000038331
Gene Namespecial AT-rich sequence binding protein 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location56793981-56978650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56891220 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 215 (S215P)
Ref Sequence ENSEMBL: ENSMUSP00000110057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042857] [ENSMUST00000114415] [ENSMUST00000177424]
Predicted Effect probably damaging
Transcript: ENSMUST00000042857
AA Change: S156P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046067
Gene: ENSMUSG00000038331
AA Change: S156P

DomainStartEndE-ValueType
PDB:3TUO|D 45 98 8e-19 PDB
PDB:3NZL|A 106 174 4e-35 PDB
low complexity region 235 251 N/A INTRINSIC
CUT 292 378 1.3e-36 SMART
low complexity region 381 399 N/A INTRINSIC
CUT 415 501 3.58e-39 SMART
low complexity region 510 524 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
HOX 555 618 1.06e-7 SMART
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114415
AA Change: S215P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110057
Gene: ENSMUSG00000038331
AA Change: S215P

DomainStartEndE-ValueType
Pfam:ULD 58 156 1.7e-39 PFAM
Pfam:CUTL 162 233 3.9e-46 PFAM
low complexity region 294 310 N/A INTRINSIC
CUT 351 437 1.3e-36 SMART
low complexity region 440 458 N/A INTRINSIC
CUT 474 560 3.58e-39 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 592 610 N/A INTRINSIC
HOX 614 677 1.06e-7 SMART
low complexity region 688 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177424
SMART Domains Protein: ENSMUSP00000135391
Gene: ENSMUSG00000038331

DomainStartEndE-ValueType
PDB:3TUO|D 57 115 6e-23 PDB
low complexity region 176 192 N/A INTRINSIC
CUT 233 319 1.3e-36 SMART
low complexity region 322 340 N/A INTRINSIC
CUT 356 442 3.58e-39 SMART
low complexity region 451 465 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
HOX 496 559 1.06e-7 SMART
low complexity region 570 591 N/A INTRINSIC
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation of this gene causes complete perinatal lethality and craniofacial anomalies, such as cleft palate, micrognathia, microcephaly, decreased tongue size, absent incisors and nasal capsule hypoplasia, and leads to short limbs and defects in osteoblast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Satb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Satb2 APN 1 56831541 missense possibly damaging 0.56
IGL02008:Satb2 APN 1 56796793 missense possibly damaging 0.70
IGL02209:Satb2 APN 1 56871518 missense probably damaging 1.00
IGL02956:Satb2 APN 1 56948175 missense probably damaging 0.99
IGL03214:Satb2 APN 1 56845580 missense probably damaging 1.00
IGL03272:Satb2 APN 1 56845643 missense probably damaging 1.00
IGL03356:Satb2 APN 1 56891174 missense probably damaging 1.00
R0990:Satb2 UTSW 1 56850184 missense probably damaging 0.96
R1534:Satb2 UTSW 1 56948233 nonsense probably null
R1711:Satb2 UTSW 1 56850289 missense probably damaging 0.99
R1952:Satb2 UTSW 1 56899070 missense probably damaging 1.00
R2404:Satb2 UTSW 1 56948108 missense probably damaging 1.00
R3792:Satb2 UTSW 1 56845620 missense probably damaging 1.00
R3870:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R4333:Satb2 UTSW 1 56845586 missense probably damaging 1.00
R4621:Satb2 UTSW 1 56845619 missense probably damaging 1.00
R4962:Satb2 UTSW 1 56891168 missense probably benign 0.25
R5296:Satb2 UTSW 1 56796907 missense probably damaging 0.99
R5314:Satb2 UTSW 1 56831527 missense probably damaging 0.99
R5407:Satb2 UTSW 1 56948150 missense probably damaging 1.00
R5925:Satb2 UTSW 1 56796938 missense possibly damaging 0.80
R6355:Satb2 UTSW 1 56948197 missense probably damaging 1.00
R6634:Satb2 UTSW 1 56845721 nonsense probably null
R6645:Satb2 UTSW 1 56797007 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CGTCAGTGCTCATTCCAACTTG -3'
(R):5'- TCGTTTGTAGAGGAGTCATAGC -3'

Sequencing Primer
(F):5'- GTGCTCATTCCAACTTGTTAATCAG -3'
(R):5'- GTTTGTAGAGGAGTCATAGCTTTAAG -3'
Posted On2015-04-06