Incidental Mutation 'R3871:Unc119b'
ID276559
Institutional Source Beutler Lab
Gene Symbol Unc119b
Ensembl Gene ENSMUSG00000046562
Gene Nameunc-119 lipid binding chaperone B
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115122550-115134975 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115130508 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 106 (T106M)
Ref Sequence ENSEMBL: ENSMUSP00000055475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060798]
Predicted Effect probably damaging
Transcript: ENSMUST00000060798
AA Change: T106M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055475
Gene: ENSMUSG00000046562
AA Change: T106M

DomainStartEndE-ValueType
low complexity region 18 35 N/A INTRINSIC
Pfam:GMP_PDE_delta 88 247 3.8e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153403
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Unc119b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Unc119b APN 5 115127312 missense probably benign 0.05
IGL02207:Unc119b APN 5 115134754 missense probably benign
R1695:Unc119b UTSW 5 115134826 nonsense probably null
R2306:Unc119b UTSW 5 115125475 nonsense probably null
R4970:Unc119b UTSW 5 115125494 missense probably damaging 0.97
R5112:Unc119b UTSW 5 115125494 missense probably damaging 0.97
R5933:Unc119b UTSW 5 115127449 intron probably benign
R5977:Unc119b UTSW 5 115130553 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CATGGTGAAAGGCGCATGTC -3'
(R):5'- TTGGGGAACATTTTCAGTGAATTGC -3'

Sequencing Primer
(F):5'- TGGTACATTCTGGCACACACAGG -3'
(R):5'- TTTCAGTGAATTGCATAGAAGACC -3'
Posted On2015-04-06