Incidental Mutation 'R3871:Tas2r122'
ID276560
Institutional Source Beutler Lab
Gene Symbol Tas2r122
Ensembl Gene ENSMUSG00000078280
Gene Nametaste receptor, type 2, member 122
SynonymsTas2r22, T2R22, mGR22
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location132710999-132711928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 132711580 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 117 (S117P)
Ref Sequence ENSEMBL: ENSMUSP00000100699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105077]
Predicted Effect probably benign
Transcript: ENSMUST00000105077
AA Change: S117P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100699
Gene: ENSMUSG00000078280
AA Change: S117P

DomainStartEndE-ValueType
Pfam:TAS2R 1 302 2.3e-73 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Tas2r122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Tas2r122 APN 6 132711762 missense possibly damaging 0.87
IGL02478:Tas2r122 APN 6 132711615 missense possibly damaging 0.81
IGL02605:Tas2r122 APN 6 132711609 missense probably damaging 0.99
IGL02646:Tas2r122 APN 6 132711790 missense probably damaging 1.00
IGL02716:Tas2r122 APN 6 132711264 missense probably damaging 1.00
R0318:Tas2r122 UTSW 6 132711832 missense possibly damaging 0.90
R0462:Tas2r122 UTSW 6 132711178 missense probably benign 0.06
R0532:Tas2r122 UTSW 6 132711828 missense possibly damaging 0.94
R0538:Tas2r122 UTSW 6 132711815 missense probably benign 0.06
R0570:Tas2r122 UTSW 6 132711811 missense probably damaging 1.00
R1863:Tas2r122 UTSW 6 132711102 nonsense probably null
R1966:Tas2r122 UTSW 6 132711194 nonsense probably null
R2001:Tas2r122 UTSW 6 132711622 missense possibly damaging 0.91
R3500:Tas2r122 UTSW 6 132711560 missense probably damaging 1.00
R4174:Tas2r122 UTSW 6 132711876 missense probably damaging 0.96
R5533:Tas2r122 UTSW 6 132711430 missense probably damaging 1.00
R5567:Tas2r122 UTSW 6 132711372 missense probably benign 0.28
R6455:Tas2r122 UTSW 6 132711663 nonsense probably null
R6716:Tas2r122 UTSW 6 132711897 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCTATGGTAGACTAAGAAACCAC -3'
(R):5'- TTGGTTGGCCATCTCCAGAATG -3'

Sequencing Primer
(F):5'- ACCACTTAGAGTATCTAAAACAGGG -3'
(R):5'- CCAGAATGTGTGTTCTATGGACAAC -3'
Posted On2015-04-06