Incidental Mutation 'R3871:Tnpo2'
ID276563
Institutional Source Beutler Lab
Gene Symbol Tnpo2
Ensembl Gene ENSMUSG00000031691
Gene Nametransportin 2 (importin 3, karyopherin beta 2b)
SynonymsKpnb2b, TRN2, 1110034O24Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location85036915-85057583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85054751 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 789 (C789S)
Ref Sequence ENSEMBL: ENSMUSP00000133076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093360] [ENSMUST00000166592] [ENSMUST00000211601]
Predicted Effect probably null
Transcript: ENSMUST00000093360
AA Change: C789S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000091051
Gene: ENSMUSG00000031691
AA Change: C789S

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 1.2e-13 PFAM
Pfam:HEAT 436 466 2.8e-6 PFAM
Pfam:HEAT 665 695 6.4e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156084
Predicted Effect probably null
Transcript: ENSMUST00000166592
AA Change: C789S

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133076
Gene: ENSMUSG00000031691
AA Change: C789S

DomainStartEndE-ValueType
IBN_N 31 99 5.72e-6 SMART
low complexity region 348 369 N/A INTRINSIC
low complexity region 389 407 N/A INTRINSIC
Pfam:HEAT_EZ 408 462 2.7e-15 PFAM
Pfam:HEAT 436 466 2.7e-6 PFAM
Pfam:HEAT 665 695 2.1e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210576
Predicted Effect probably null
Transcript: ENSMUST00000211601
AA Change: C779S

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Tnpo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Tnpo2 APN 8 85040526 missense probably damaging 0.98
IGL01843:Tnpo2 APN 8 85050508 missense probably damaging 0.99
IGL02475:Tnpo2 APN 8 85050502 missense probably benign 0.33
IGL02536:Tnpo2 APN 8 85045067 missense probably benign
IGL02644:Tnpo2 APN 8 85044480 missense possibly damaging 0.62
IGL02721:Tnpo2 APN 8 85054690 critical splice acceptor site probably null
IGL03155:Tnpo2 APN 8 85045080 missense probably benign 0.03
IGL03198:Tnpo2 APN 8 85051718 missense possibly damaging 0.75
R0127:Tnpo2 UTSW 8 85040628 missense probably damaging 1.00
R0456:Tnpo2 UTSW 8 85054416 missense probably damaging 1.00
R0505:Tnpo2 UTSW 8 85047362 missense probably benign 0.01
R0513:Tnpo2 UTSW 8 85053529 missense probably benign 0.00
R0531:Tnpo2 UTSW 8 85050157 missense probably damaging 1.00
R0595:Tnpo2 UTSW 8 85052041 nonsense probably null
R1113:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1308:Tnpo2 UTSW 8 85055353 missense probably damaging 1.00
R1851:Tnpo2 UTSW 8 85051772 missense probably damaging 1.00
R1965:Tnpo2 UTSW 8 85045317 critical splice donor site probably null
R2057:Tnpo2 UTSW 8 85050113 missense probably damaging 1.00
R2184:Tnpo2 UTSW 8 85053846 missense probably benign 0.35
R3801:Tnpo2 UTSW 8 85055171 splice site probably null
R4095:Tnpo2 UTSW 8 85038419 missense probably damaging 1.00
R4611:Tnpo2 UTSW 8 85053803 missense probably benign 0.38
R4925:Tnpo2 UTSW 8 85050025 missense probably damaging 1.00
R5744:Tnpo2 UTSW 8 85051894 nonsense probably null
R6107:Tnpo2 UTSW 8 85053475 missense probably damaging 1.00
R6581:Tnpo2 UTSW 8 85055404 missense probably damaging 1.00
R6586:Tnpo2 UTSW 8 85045202 missense possibly damaging 0.83
X0027:Tnpo2 UTSW 8 85044895 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTATGGGCCAAACTCAAGG -3'
(R):5'- CAGGTCAGTGGATGGACTTG -3'

Sequencing Primer
(F):5'- ACTCAAGGGCCCAGGATAGC -3'
(R):5'- TGGAGGGTACAGCTGTC -3'
Posted On2015-04-06