Incidental Mutation 'R3871:Nt5e'
ID276565
Institutional Source Beutler Lab
Gene Symbol Nt5e
Ensembl Gene ENSMUSG00000032420
Gene Name5' nucleotidase, ecto
Synonymsecto-5'-nucleotidase, CD73, Nt5, 2210401F01Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location88327197-88372092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 88364693 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 327 (N327K)
Ref Sequence ENSEMBL: ENSMUSP00000034992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034992]
Predicted Effect probably benign
Transcript: ENSMUST00000034992
AA Change: N327K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000034992
Gene: ENSMUSG00000032420
AA Change: N327K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Metallophos 31 248 2.1e-15 PFAM
Pfam:5_nucleotid_C 340 515 4.9e-45 PFAM
transmembrane domain 553 575 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187166
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a membrane-bound nucleotidase that hydrolyzes extracellular nucleoside monophosphates. The encoded preproprotein undergoes proteolytic processing to generate to a functional, homodimeric enzyme that preferentially uses adenosine monophosphate as a substrate to generate free adenosine. Mice lacking the encoded protein exhibit a significantly reduced fall in stop flow pressure and superficial nephron glomerular filtration rate in response to a saturating increase of tubular perfusion flow. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous null mice for one allele are viable and fertile with increased circulating alkaline phosphatase and impaired tubuloglomerular feedback regulation. Homozygous null mice for a second allele display increased vascular permeability especially under hypoxic conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Nt5e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01794:Nt5e APN 9 88367298 missense probably damaging 0.97
IGL02015:Nt5e APN 9 88367237 missense probably damaging 1.00
IGL02351:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02358:Nt5e APN 9 88327893 missense probably damaging 1.00
IGL02826:Nt5e APN 9 88355705 missense probably damaging 0.97
IGL03237:Nt5e APN 9 88355734 missense probably damaging 1.00
R0092:Nt5e UTSW 9 88370285 missense probably benign 0.00
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0238:Nt5e UTSW 9 88367332 missense possibly damaging 0.81
R0557:Nt5e UTSW 9 88366466 missense probably damaging 1.00
R1727:Nt5e UTSW 9 88328029 missense possibly damaging 0.87
R1834:Nt5e UTSW 9 88370187 missense probably damaging 1.00
R2361:Nt5e UTSW 9 88370237 missense possibly damaging 0.67
R4990:Nt5e UTSW 9 88355593 missense probably benign 0.03
R5039:Nt5e UTSW 9 88363581 missense probably benign 0.00
R5642:Nt5e UTSW 9 88327687 start codon destroyed probably null 0.02
R5812:Nt5e UTSW 9 88369055 missense probably damaging 1.00
R6389:Nt5e UTSW 9 88363471 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAGGGATTTTATAGCCACAACC -3'
(R):5'- AGTCATGCTTCTGTCTGGGC -3'

Sequencing Primer
(F):5'- GGATTTTATAGCCACAACCAAAATGC -3'
(R):5'- CTTCTGTCTGGGCACAAAATG -3'
Posted On2015-04-06