Incidental Mutation 'R3871:Tmem26'
ID276566
Institutional Source Beutler Lab
Gene Symbol Tmem26
Ensembl Gene ENSMUSG00000060044
Gene Nametransmembrane protein 26
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location68723646-68782650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 68778732 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 326 (E326K)
Ref Sequence ENSEMBL: ENSMUSP00000079789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080995] [ENSMUST00000218918]
Predicted Effect probably benign
Transcript: ENSMUST00000080995
AA Change: E326K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000079789
Gene: ENSMUSG00000060044
AA Change: E326K

DomainStartEndE-ValueType
Pfam:Tmem26 3 304 5.6e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218918
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Tmem26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmem26 APN 10 68775354 missense probably damaging 1.00
IGL00471:Tmem26 APN 10 68778681 missense possibly damaging 0.78
IGL01301:Tmem26 APN 10 68778606 missense probably damaging 1.00
IGL01567:Tmem26 APN 10 68751231 missense probably damaging 1.00
IGL02487:Tmem26 APN 10 68778733 missense probably benign 0.00
IGL02713:Tmem26 APN 10 68751295 missense probably damaging 1.00
IGL02828:Tmem26 APN 10 68775385 critical splice donor site probably null
ANU18:Tmem26 UTSW 10 68778606 missense probably damaging 1.00
P0027:Tmem26 UTSW 10 68778718 missense probably benign 0.00
R1415:Tmem26 UTSW 10 68778661 missense possibly damaging 0.93
R1649:Tmem26 UTSW 10 68751273 missense probably damaging 1.00
R5072:Tmem26 UTSW 10 68775348 missense probably damaging 1.00
R5239:Tmem26 UTSW 10 68751266 missense probably damaging 0.97
R6053:Tmem26 UTSW 10 68748484 missense probably benign 0.00
R6607:Tmem26 UTSW 10 68778713 missense probably benign 0.00
R6710:Tmem26 UTSW 10 68724054 missense probably damaging 1.00
T0722:Tmem26 UTSW 10 68778718 missense probably benign 0.00
X0003:Tmem26 UTSW 10 68778718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGGGCCATTGGTCTCAGC -3'
(R):5'- CTGGTGTATGCAAACATGGG -3'

Sequencing Primer
(F):5'- AGCTTCTTCATCCAAGACGG -3'
(R):5'- TATGCAAACATGGGGGCGTAAG -3'
Posted On2015-04-06