Incidental Mutation 'R3871:Sf3a2'
ID276567
Institutional Source Beutler Lab
Gene Symbol Sf3a2
Ensembl Gene ENSMUSG00000020211
Gene Namesplicing factor 3a, subunit 2
SynonymsSFA66, Sap62, PRP11, 66kDa
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R3871 (G1)
Quality Score139
Status Not validated
Chromosome10
Chromosomal Location80798198-80804924 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to C at 80804693 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020435] [ENSMUST00000036016] [ENSMUST00000147440] [ENSMUST00000148665] [ENSMUST00000151928] [ENSMUST00000181039] [ENSMUST00000181945]
Predicted Effect probably benign
Transcript: ENSMUST00000020435
SMART Domains Protein: ENSMUSP00000020435
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 52 77 N/A INTRINSIC
Pfam:JSRP 79 138 1e-29 PFAM
low complexity region 145 158 N/A INTRINSIC
low complexity region 179 192 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036016
SMART Domains Protein: ENSMUSP00000043153
Gene: ENSMUSG00000035262

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 38 52 N/A INTRINSIC
Pfam:AMH_N 75 439 3e-133 PFAM
TGFB 456 554 8.57e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139461
Predicted Effect probably benign
Transcript: ENSMUST00000147440
SMART Domains Protein: ENSMUSP00000116478
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
Blast:CactinC_cactus 41 67 1e-9 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000148665
AA Change: Q446P
SMART Domains Protein: ENSMUSP00000117160
Gene: ENSMUSG00000020211
AA Change: Q446P

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 219 8.29e-35 SMART
low complexity region 300 318 N/A INTRINSIC
low complexity region 320 420 N/A INTRINSIC
low complexity region 423 452 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151928
SMART Domains Protein: ENSMUSP00000114164
Gene: ENSMUSG00000020211

DomainStartEndE-ValueType
low complexity region 18 36 N/A INTRINSIC
ZnF_U1 51 85 5.02e-9 SMART
ZnF_C2H2 54 78 1.23e1 SMART
CactinC_cactus 91 194 1.26e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181039
SMART Domains Protein: ENSMUSP00000137666
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
low complexity region 92 117 N/A INTRINSIC
Pfam:JSRP 118 179 1e-31 PFAM
low complexity region 185 198 N/A INTRINSIC
low complexity region 219 232 N/A INTRINSIC
low complexity region 245 270 N/A INTRINSIC
low complexity region 313 324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000181945
SMART Domains Protein: ENSMUSP00000137960
Gene: ENSMUSG00000020216

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Sf3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01717:Sf3a2 APN 10 80804692 nonsense probably null
IGL02997:Sf3a2 APN 10 80803620 missense probably damaging 1.00
R0470:Sf3a2 UTSW 10 80804554 unclassified probably benign
R1436:Sf3a2 UTSW 10 80804206 unclassified probably benign
R1437:Sf3a2 UTSW 10 80804206 unclassified probably benign
R2233:Sf3a2 UTSW 10 80802829 missense probably benign 0.05
R2234:Sf3a2 UTSW 10 80802829 missense probably benign 0.05
R4116:Sf3a2 UTSW 10 80801341 missense probably damaging 0.98
R4659:Sf3a2 UTSW 10 80803584 missense probably damaging 1.00
R4946:Sf3a2 UTSW 10 80804113 unclassified probably benign
R5081:Sf3a2 UTSW 10 80804441 unclassified probably benign
R5618:Sf3a2 UTSW 10 80804576 unclassified probably benign
R6039:Sf3a2 UTSW 10 80801463 missense probably damaging 1.00
R6039:Sf3a2 UTSW 10 80801463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCCATCCACCAACATCTG -3'
(R):5'- TTAATAGGCTCAAGGCAGGAC -3'

Sequencing Primer
(F):5'- CAACATCTGGGGTCCATCC -3'
(R):5'- CTTCCAAGGACTGGCAATGG -3'
Posted On2015-04-06