Incidental Mutation 'R3871:Ccdc40'
ID276569
Institutional Source Beutler Lab
Gene Symbol Ccdc40
Ensembl Gene ENSMUSG00000039963
Gene Namecoiled-coil domain containing 40
SynonymsB930008I02Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location119228572-119265236 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119264281 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1116 (V1116M)
Ref Sequence ENSEMBL: ENSMUSP00000039463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026666] [ENSMUST00000035935] [ENSMUST00000053440] [ENSMUST00000106258] [ENSMUST00000106259]
Predicted Effect probably benign
Transcript: ENSMUST00000026666
SMART Domains Protein: ENSMUSP00000026666
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:Gal_mutarotas_2 254 320 3.7e-12 PFAM
Pfam:Glyco_hydro_31 340 825 8.8e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000035935
AA Change: V1116M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039463
Gene: ENSMUSG00000039963
AA Change: V1116M

DomainStartEndE-ValueType
internal_repeat_1 7 48 1.25e-8 PROSPERO
internal_repeat_1 55 96 1.25e-8 PROSPERO
low complexity region 159 170 N/A INTRINSIC
low complexity region 208 232 N/A INTRINSIC
coiled coil region 349 371 N/A INTRINSIC
coiled coil region 423 447 N/A INTRINSIC
Blast:HisKA 450 519 3e-13 BLAST
Blast:HisKA 574 629 5e-8 BLAST
low complexity region 793 805 N/A INTRINSIC
Pfam:BRE1 830 928 4.2e-20 PFAM
coiled coil region 1044 1112 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000053440
SMART Domains Protein: ENSMUSP00000062198
Gene: ENSMUSG00000039963

DomainStartEndE-ValueType
low complexity region 5 27 N/A INTRINSIC
low complexity region 56 70 N/A INTRINSIC
internal_repeat_1 79 114 5.57e-8 PROSPERO
internal_repeat_1 111 150 5.57e-8 PROSPERO
low complexity region 229 240 N/A INTRINSIC
low complexity region 278 302 N/A INTRINSIC
coiled coil region 419 441 N/A INTRINSIC
coiled coil region 493 517 N/A INTRINSIC
Blast:HisKA 520 589 2e-13 BLAST
Blast:HisKA 644 699 4e-8 BLAST
low complexity region 863 875 N/A INTRINSIC
Pfam:BRE1 900 998 4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106258
SMART Domains Protein: ENSMUSP00000101865
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106259
SMART Domains Protein: ENSMUSP00000101866
Gene: ENSMUSG00000025579

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
PD 80 134 1.08e-15 SMART
Pfam:NtCtMGAM_N 147 253 3.5e-32 PFAM
Pfam:Gal_mutarotas_2 254 320 6.5e-12 PFAM
Pfam:Glyco_hydro_31 340 825 1.8e-153 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133788
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155683
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is necessary for motile cilia function. It functions in correct left-right axis formation by regulating the assembly of the inner dynein arm and the dynein regulatory complexes, which control ciliary beat. Mutations in this gene cause ciliary dyskinesia type 15, a disorder due to defects in cilia motility. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit heterotaxia, hydrocephalus, short embryonic cilia, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Ccdc40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ccdc40 APN 11 119242719 missense possibly damaging 0.90
IGL01864:Ccdc40 APN 11 119243085 missense probably benign 0.23
IGL01911:Ccdc40 APN 11 119231971 unclassified probably null
IGL02640:Ccdc40 APN 11 119238078 missense probably benign 0.18
IGL03278:Ccdc40 APN 11 119242510 missense probably damaging 1.00
IGL03054:Ccdc40 UTSW 11 119263201 missense possibly damaging 0.69
R0139:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0140:Ccdc40 UTSW 11 119264299 missense probably benign 0.00
R0415:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
R0617:Ccdc40 UTSW 11 119242804 missense probably damaging 1.00
R1396:Ccdc40 UTSW 11 119231803 missense possibly damaging 0.66
R1531:Ccdc40 UTSW 11 119263189 missense probably benign 0.01
R1751:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1767:Ccdc40 UTSW 11 119230696 critical splice donor site probably null
R1870:Ccdc40 UTSW 11 119259904 missense possibly damaging 0.81
R1971:Ccdc40 UTSW 11 119263075 unclassified probably null
R2106:Ccdc40 UTSW 11 119264297 missense probably damaging 1.00
R2370:Ccdc40 UTSW 11 119263117 missense probably benign 0.00
R3421:Ccdc40 UTSW 11 119234779 missense probably benign 0.02
R3746:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R3749:Ccdc40 UTSW 11 119264426 missense probably benign 0.26
R4508:Ccdc40 UTSW 11 119242509 missense probably damaging 0.98
R4613:Ccdc40 UTSW 11 119231532 missense probably benign 0.09
R4663:Ccdc40 UTSW 11 119231506 missense probably benign 0.01
R4787:Ccdc40 UTSW 11 119253621 missense possibly damaging 0.74
R4867:Ccdc40 UTSW 11 119231788 missense probably benign
R5237:Ccdc40 UTSW 11 119259976 missense probably benign 0.00
R5661:Ccdc40 UTSW 11 119237927 missense probably benign 0.13
R5678:Ccdc40 UTSW 11 119231572 missense possibly damaging 0.61
R5805:Ccdc40 UTSW 11 119246080 critical splice donor site probably null
R5830:Ccdc40 UTSW 11 119242746 missense probably benign 0.00
R5895:Ccdc40 UTSW 11 119253403 missense probably damaging 1.00
R5932:Ccdc40 UTSW 11 119251012 missense probably damaging 0.98
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6034:Ccdc40 UTSW 11 119243072 missense possibly damaging 0.70
R6109:Ccdc40 UTSW 11 119231978 missense probably benign
R6166:Ccdc40 UTSW 11 119232001 missense probably benign
R6336:Ccdc40 UTSW 11 119231993 missense possibly damaging 0.82
R6569:Ccdc40 UTSW 11 119242734 missense probably damaging 1.00
R6884:Ccdc40 UTSW 11 119242739 missense possibly damaging 0.82
S24628:Ccdc40 UTSW 11 119232118 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ACTTCAGAGGCATGGCAAACC -3'
(R):5'- AAGTCAGCCCTGAAAGGTGC -3'

Sequencing Primer
(F):5'- CCTGAATGAATCCCAGTGTCTGAG -3'
(R):5'- CTGTTGAATGCTCTGCAGC -3'
Posted On2015-04-06