Incidental Mutation 'R3871:Rab24'
ID276574
Institutional Source Beutler Lab
Gene Symbol Rab24
Ensembl Gene ENSMUSG00000034789
Gene NameRAB24, member RAS oncogene family
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55319743-55321946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55321179 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 63 (D63G)
Ref Sequence ENSEMBL: ENSMUSP00000046188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021941] [ENSMUST00000021942] [ENSMUST00000035242] [ENSMUST00000099490] [ENSMUST00000224685]
Predicted Effect probably benign
Transcript: ENSMUST00000021941
SMART Domains Protein: ENSMUSP00000021941
Gene: ENSMUSG00000021485

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
HLH 63 115 5.8e-11 SMART
low complexity region 119 138 N/A INTRINSIC
low complexity region 148 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021942
SMART Domains Protein: ENSMUSP00000021942
Gene: ENSMUSG00000021486

DomainStartEndE-ValueType
Pfam:PRELI 16 172 1.9e-61 PFAM
coiled coil region 178 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035242
AA Change: D63G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046188
Gene: ENSMUSG00000034789
AA Change: D63G

DomainStartEndE-ValueType
RAB 8 175 2.39e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099490
SMART Domains Protein: ENSMUSP00000097089
Gene: ENSMUSG00000021488

DomainStartEndE-ValueType
low complexity region 177 187 N/A INTRINSIC
low complexity region 281 289 N/A INTRINSIC
PWWP 322 388 1.97e-3 SMART
low complexity region 635 644 N/A INTRINSIC
low complexity region 980 1000 N/A INTRINSIC
low complexity region 1296 1309 N/A INTRINSIC
PHD 1546 1588 4.25e-8 SMART
PHD 1593 1640 3.79e-5 SMART
RING 1594 1639 1.08e-1 SMART
PHD 1641 1694 1.09e1 SMART
PHD 1710 1750 1.02e-10 SMART
PWWP 1755 1817 8.87e-29 SMART
AWS 1891 1942 3.02e-22 SMART
SET 1943 2066 1e-45 SMART
PostSET 2067 2083 3.99e-3 SMART
PHD 2121 2164 1.08e-9 SMART
low complexity region 2224 2237 N/A INTRINSIC
low complexity region 2276 2286 N/A INTRINSIC
low complexity region 2335 2356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146181
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223672
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224220
Predicted Effect probably benign
Transcript: ENSMUST00000224685
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224936
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225561
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAB24 is a small GTPase of the Rab subfamily of Ras-related proteins that regulate intracellular protein trafficking (Olkkonen et al., 1993 [PubMed 8126105]).[supplied by OMIM, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Rab24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0518:Rab24 UTSW 13 55320925 critical splice donor site probably null
R0521:Rab24 UTSW 13 55320925 critical splice donor site probably null
R5935:Rab24 UTSW 13 55320530 missense probably damaging 1.00
R5964:Rab24 UTSW 13 55321576 missense probably damaging 1.00
V1024:Rab24 UTSW 13 55320748 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AACTTGGCTCTCTCAAAGCTGC -3'
(R):5'- TTGTGCAAACCTGTCTCCCG -3'

Sequencing Primer
(F):5'- CTGCTGCTGTCAGTGAGGTC -3'
(R):5'- GCAAACCTGTCTCCCGAATTTAATG -3'
Posted On2015-04-06