Incidental Mutation 'R3871:Rubcnl'
ID276576
Institutional Source Beutler Lab
Gene Symbol Rubcnl
Ensembl Gene ENSMUSG00000034959
Gene NameRUN and cysteine rich domain containing beclin 1 interacting protein like
SynonymsLOC380917, 5031414D18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.186) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location75016027-75052532 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75040916 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 380 (P380L)
Ref Sequence ENSEMBL: ENSMUSP00000045566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036072]
Predicted Effect probably benign
Transcript: ENSMUST00000036072
AA Change: P380L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045566
Gene: ENSMUSG00000034959
AA Change: P380L

DomainStartEndE-ValueType
DUF4206 463 664 1.01e-108 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228689
Meta Mutation Damage Score 0.1232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Rubcnl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02571:Rubcnl APN 14 75032136 missense possibly damaging 0.75
IGL02730:Rubcnl APN 14 75050148 missense probably damaging 1.00
R0019:Rubcnl UTSW 14 75048263 splice site probably benign
R0147:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0148:Rubcnl UTSW 14 75042458 missense probably damaging 1.00
R0350:Rubcnl UTSW 14 75040891 missense probably damaging 0.99
R0487:Rubcnl UTSW 14 75036081 missense probably benign 0.18
R0558:Rubcnl UTSW 14 75047547 missense probably damaging 1.00
R1537:Rubcnl UTSW 14 75040827 missense possibly damaging 0.92
R1791:Rubcnl UTSW 14 75047549 missense probably damaging 1.00
R1871:Rubcnl UTSW 14 75042409 missense possibly damaging 0.58
R2227:Rubcnl UTSW 14 75042392 missense probably benign 0.00
R2263:Rubcnl UTSW 14 75040820 missense possibly damaging 0.93
R2910:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R2911:Rubcnl UTSW 14 75040808 missense probably benign 0.06
R3826:Rubcnl UTSW 14 75032225 missense possibly damaging 0.72
R3870:Rubcnl UTSW 14 75040916 missense probably benign 0.00
R4007:Rubcnl UTSW 14 75049703 missense possibly damaging 0.93
R4161:Rubcnl UTSW 14 75044458 missense possibly damaging 0.82
R5004:Rubcnl UTSW 14 75032177 nonsense probably null
R5041:Rubcnl UTSW 14 75050132 missense probably damaging 1.00
R5468:Rubcnl UTSW 14 75032031 missense possibly damaging 0.49
R5495:Rubcnl UTSW 14 75042337 missense possibly damaging 0.61
R5739:Rubcnl UTSW 14 75040941 splice site probably null
R5910:Rubcnl UTSW 14 75035472 missense probably benign 0.26
R5948:Rubcnl UTSW 14 75047616 missense probably damaging 1.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6038:Rubcnl UTSW 14 75031970 missense probably benign 0.00
R6197:Rubcnl UTSW 14 75031929 missense probably damaging 0.99
R6297:Rubcnl UTSW 14 75050144 missense probably benign 0.06
R6372:Rubcnl UTSW 14 75047569 missense probably damaging 0.99
R6376:Rubcnl UTSW 14 75032394 missense probably benign 0.01
R6377:Rubcnl UTSW 14 75050195 splice site probably null
R6724:Rubcnl UTSW 14 75052010 missense probably benign 0.00
R6884:Rubcnl UTSW 14 75035470 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATGAGAAACTCTGTTTGCTGATCAC -3'
(R):5'- TGTGAATTGTTCAGGACATCCCC -3'

Sequencing Primer
(F):5'- GGGTCGACTCTATCACATCAGATG -3'
(R):5'- ATCCCCTGATGCTGAATGACTG -3'
Posted On2015-04-06