Mutagenetix > Incidental Mutations

Incidental Mutation 'R3871:Kmt2d'

276578

Institutional Source

Beutler Lab

Gene Symbol

Kmt2d

Ensembl Gene

ENSMUSG00000048154

Gene Name

lysine (K)-specific methyltransferase 2D

Synonyms

Mll2, C430014K11Rik, Mll4

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3871 (G1)

Quality Score

180

Status

Not validated

Chromosome

Chromosomal Location

98831669-98871204 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

TTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGC at 98851021 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486] [ENSMUST00000184363]

Predicted Effect

probably benign
Transcript: ENSMUST00000023741

SMART Domains

Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
PHD	171	218	1.65e-5	SMART
RING	172	217	2.01e0	SMART
PHD	228	274	2.13e-8	SMART
RING	229	273	2.11e-3	SMART
PHD	275	321	1.57e-11	SMART
RING	276	320	2.36e0	SMART
low complexity region	430	489	N/A	INTRINSIC
low complexity region	500	562	N/A	INTRINSIC
low complexity region	564	613	N/A	INTRINSIC
low complexity region	619	717	N/A	INTRINSIC
internal_repeat_3	719	768	2.82e-8	PROSPERO
internal_repeat_3	773	822	2.82e-8	PROSPERO
low complexity region	826	842	N/A	INTRINSIC
low complexity region	844	919	N/A	INTRINSIC
low complexity region	958	981	N/A	INTRINSIC
low complexity region	985	1023	N/A	INTRINSIC
low complexity region	1069	1076	N/A	INTRINSIC
low complexity region	1139	1153	N/A	INTRINSIC
low complexity region	1259	1285	N/A	INTRINSIC
low complexity region	1307	1314	N/A	INTRINSIC
PHD	1335	1384	7.01e-9	SMART
RING	1336	1383	1.46e1	SMART
PHD	1385	1431	8.56e-13	SMART
PHD	1462	1513	1.11e-6	SMART
RING	1463	1512	1.46e1	SMART
low complexity region	1514	1538	N/A	INTRINSIC
low complexity region	1567	1576	N/A	INTRINSIC
low complexity region	1589	1612	N/A	INTRINSIC
low complexity region	1634	1646	N/A	INTRINSIC
low complexity region	1707	1719	N/A	INTRINSIC
low complexity region	1883	1896	N/A	INTRINSIC
low complexity region	1931	1950	N/A	INTRINSIC
HMG	1969	2037	6.35e-6	SMART
low complexity region	2064	2079	N/A	INTRINSIC
low complexity region	2147	2167	N/A	INTRINSIC
low complexity region	2170	2181	N/A	INTRINSIC
low complexity region	2306	2323	N/A	INTRINSIC
low complexity region	2334	2359	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2402	2419	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2610	2622	N/A	INTRINSIC
coiled coil region	2632	2665	N/A	INTRINSIC
coiled coil region	2768	2813	N/A	INTRINSIC
low complexity region	2855	2868	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	3151	3165	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
low complexity region	3241	3263	N/A	INTRINSIC
low complexity region	3390	3400	N/A	INTRINSIC
low complexity region	3629	3659	N/A	INTRINSIC
coiled coil region	3712	3749	N/A	INTRINSIC
low complexity region	3781	3801	N/A	INTRINSIC
coiled coil region	3910	4003	N/A	INTRINSIC
low complexity region	4128	4159	N/A	INTRINSIC
low complexity region	4167	4183	N/A	INTRINSIC
low complexity region	4226	4246	N/A	INTRINSIC
low complexity region	4266	4293	N/A	INTRINSIC
low complexity region	4306	4322	N/A	INTRINSIC
low complexity region	4361	4378	N/A	INTRINSIC
coiled coil region	4591	4613	N/A	INTRINSIC
low complexity region	4661	4684	N/A	INTRINSIC
low complexity region	4745	4755	N/A	INTRINSIC
low complexity region	4877	4896	N/A	INTRINSIC
low complexity region	4957	4983	N/A	INTRINSIC
low complexity region	4989	5029	N/A	INTRINSIC
low complexity region	5100	5107	N/A	INTRINSIC
PHD	5142	5188	4.67e-5	SMART
RING	5143	5187	4.87e0	SMART
FYRN	5242	5285	5.07e-21	SMART
FYRC	5291	5378	2.51e-43	SMART
SET	5448	5570	5.69e-36	SMART
PostSET	5572	5588	3.58e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000178486

SMART Domains

Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154

Domain	Start	End	E-Value	Type
low complexity region	135	145	N/A	INTRINSIC
PHD	171	218	1.65e-5	SMART
RING	172	217	2.01e0	SMART
PHD	228	274	2.13e-8	SMART
RING	229	273	2.11e-3	SMART
PHD	275	321	1.57e-11	SMART
RING	276	320	2.36e0	SMART
low complexity region	430	489	N/A	INTRINSIC
low complexity region	500	562	N/A	INTRINSIC
low complexity region	564	613	N/A	INTRINSIC
low complexity region	619	717	N/A	INTRINSIC
internal_repeat_3	719	768	2.82e-8	PROSPERO
internal_repeat_3	773	822	2.82e-8	PROSPERO
low complexity region	826	842	N/A	INTRINSIC
low complexity region	844	919	N/A	INTRINSIC
low complexity region	958	981	N/A	INTRINSIC
low complexity region	985	1023	N/A	INTRINSIC
low complexity region	1069	1076	N/A	INTRINSIC
low complexity region	1139	1153	N/A	INTRINSIC
low complexity region	1259	1285	N/A	INTRINSIC
low complexity region	1307	1314	N/A	INTRINSIC
PHD	1335	1384	7.01e-9	SMART
RING	1336	1383	1.46e1	SMART
PHD	1385	1431	8.56e-13	SMART
PHD	1462	1513	1.11e-6	SMART
RING	1463	1512	1.46e1	SMART
low complexity region	1514	1538	N/A	INTRINSIC
low complexity region	1567	1576	N/A	INTRINSIC
low complexity region	1589	1612	N/A	INTRINSIC
low complexity region	1634	1646	N/A	INTRINSIC
low complexity region	1707	1719	N/A	INTRINSIC
low complexity region	1883	1896	N/A	INTRINSIC
low complexity region	1931	1950	N/A	INTRINSIC
HMG	1969	2037	6.35e-6	SMART
low complexity region	2064	2079	N/A	INTRINSIC
low complexity region	2147	2167	N/A	INTRINSIC
low complexity region	2170	2181	N/A	INTRINSIC
low complexity region	2306	2323	N/A	INTRINSIC
low complexity region	2334	2359	N/A	INTRINSIC
low complexity region	2366	2388	N/A	INTRINSIC
low complexity region	2402	2419	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2610	2622	N/A	INTRINSIC
coiled coil region	2632	2665	N/A	INTRINSIC
coiled coil region	2768	2813	N/A	INTRINSIC
low complexity region	2855	2868	N/A	INTRINSIC
low complexity region	2887	2899	N/A	INTRINSIC
low complexity region	3151	3165	N/A	INTRINSIC
low complexity region	3189	3204	N/A	INTRINSIC
low complexity region	3241	3263	N/A	INTRINSIC
low complexity region	3390	3400	N/A	INTRINSIC
low complexity region	3629	3659	N/A	INTRINSIC
coiled coil region	3712	3749	N/A	INTRINSIC
low complexity region	3781	3801	N/A	INTRINSIC
coiled coil region	3910	4003	N/A	INTRINSIC
low complexity region	4128	4159	N/A	INTRINSIC
low complexity region	4167	4183	N/A	INTRINSIC
low complexity region	4226	4246	N/A	INTRINSIC
low complexity region	4266	4293	N/A	INTRINSIC
low complexity region	4306	4322	N/A	INTRINSIC
low complexity region	4361	4378	N/A	INTRINSIC
coiled coil region	4591	4613	N/A	INTRINSIC
low complexity region	4661	4684	N/A	INTRINSIC
low complexity region	4745	4755	N/A	INTRINSIC
low complexity region	4877	4896	N/A	INTRINSIC
low complexity region	4957	4983	N/A	INTRINSIC
low complexity region	4989	5029	N/A	INTRINSIC
low complexity region	5100	5107	N/A	INTRINSIC
PHD	5142	5188	4.67e-5	SMART
RING	5143	5187	4.87e0	SMART
FYRN	5242	5285	5.07e-21	SMART
FYRC	5291	5378	2.51e-43	SMART
SET	5448	5570	5.69e-36	SMART
PostSET	5572	5588	3.58e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184363

SMART Domains

Protein: ENSMUSP00000139020
Gene: ENSMUSG00000048154

Domain	Start	End	E-Value	Type
low complexity region	73	85	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229651

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh1a1	T	A	19: 20,624,753	Y225*	probably null	Het
Bard1	T	C	1: 71,074,940	K294R	probably benign	Het
Bcap29	A	T	12: 31,617,081	S194T	probably benign	Het
Ccdc40	G	A	11: 119,264,281	V1116M	probably damaging	Het
Cntnap5a	A	G	1: 116,060,249	E170G	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp2c54	T	C	19: 40,072,423	D92G	probably benign	Het
Dpp6	T	C	5: 27,469,465	F197L	probably benign	Het
Filip1l	G	T	16: 57,513,286	K147N	probably damaging	Het
Hrnr	T	A	3: 93,331,874	S3140T	unknown	Het
Igfn1	G	T	1: 135,968,836	H1331N	probably benign	Het
Kalrn	C	T	16: 34,203,856		probably null	Het
Mfng	A	G	15: 78,756,621	L308P	probably damaging	Het
Nt5e	C	A	9: 88,364,693	N327K	probably benign	Het
Olfr1025-ps1	T	G	2: 85,918,582		probably null	Het
Pgbd1	C	T	13: 21,434,370	R39H	possibly damaging	Het
Phactr4	T	C	4: 132,377,249	T256A	probably benign	Het
Rab24	T	C	13: 55,321,179	D63G	probably damaging	Het
Rubcnl	C	T	14: 75,040,916	P380L	probably benign	Het
Satb2	A	G	1: 56,891,220	S215P	probably damaging	Het
Serpina3b	A	T	12: 104,138,788	I408F	probably damaging	Het
Setx	A	G	2: 29,145,741	D746G	probably damaging	Het
Sf3a2	A	C	10: 80,804,693		probably benign	Het
Snx33	T	C	9: 56,926,740	N15S	probably benign	Het
Snx9	C	T	17: 5,891,781	P61L	probably benign	Het
Sult2a6	T	C	7: 14,254,776	K20E	probably benign	Het
Tas2r122	A	G	6: 132,711,580	S117P	probably benign	Het
Tmem26	G	A	10: 68,778,732	E326K	probably benign	Het
Tnpo2	T	A	8: 85,054,751	C789S	probably null	Het
Togaram1	A	C	12: 65,002,645	E1285D	probably benign	Het
Ubxn7	T	A	16: 32,381,430	S335T	possibly damaging	Het
Unc119b	G	A	5: 115,130,508	T106M	probably damaging	Het
Usp14	A	G	18: 10,002,370	S314P	possibly damaging	Het
Usp32	T	C	11: 85,081,156	D129G	probably null	Het

Other mutations in Kmt2d

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Kmt2d	APN	15	98862333	missense	unknown
IGL00927:Kmt2d	APN	15	98845009	unclassified	probably benign
IGL01123:Kmt2d	APN	15	98837148	missense	unknown
IGL01288:Kmt2d	APN	15	98865044	missense	probably damaging	1.00
IGL01538:Kmt2d	APN	15	98860657	unclassified	probably benign
IGL01575:Kmt2d	APN	15	98846855	utr 3 prime	probably benign
IGL01584:Kmt2d	APN	15	98856369	unclassified	probably benign
IGL01750:Kmt2d	APN	15	98853168	unclassified	probably benign
IGL02163:Kmt2d	APN	15	98835228	unclassified	probably benign
IGL02209:Kmt2d	APN	15	98854567	unclassified	probably benign
IGL02253:Kmt2d	APN	15	98858175	unclassified	probably benign
IGL02271:Kmt2d	APN	15	98866428	missense	possibly damaging	0.89
IGL02291:Kmt2d	APN	15	98865492	splice site	probably benign
IGL02448:Kmt2d	APN	15	98844110	unclassified	probably benign
IGL02472:Kmt2d	APN	15	98850077	missense	probably benign	0.23
IGL02496:Kmt2d	APN	15	98857558	unclassified	probably benign
IGL02527:Kmt2d	APN	15	98841747	unclassified	probably benign
IGL02576:Kmt2d	APN	15	98864120	missense	unknown
IGL02597:Kmt2d	APN	15	98863831	missense	unknown
IGL02609:Kmt2d	APN	15	98851793	unclassified	probably benign
IGL03085:Kmt2d	APN	15	98839940	unclassified	probably benign
IGL03102:Kmt2d	APN	15	98855543	missense	probably benign
IGL03123:Kmt2d	APN	15	98861771	missense	unknown
R0091:Kmt2d	UTSW	15	98844479	unclassified	probably benign
R0136:Kmt2d	UTSW	15	98854278	unclassified	probably benign
R0243:Kmt2d	UTSW	15	98850137	unclassified	probably benign
R0276:Kmt2d	UTSW	15	98850311	unclassified	probably benign
R0477:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0478:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0586:Kmt2d	UTSW	15	98835207	unclassified	probably benign
R0632:Kmt2d	UTSW	15	98853581	unclassified	probably benign
R0678:Kmt2d	UTSW	15	98850413	unclassified	probably benign
R0780:Kmt2d	UTSW	15	98862857	missense	unknown
R0891:Kmt2d	UTSW	15	98852691	unclassified	probably benign
R1136:Kmt2d	UTSW	15	98857765	unclassified	probably benign
R1417:Kmt2d	UTSW	15	98866430	missense	probably damaging	0.99
R1499:Kmt2d	UTSW	15	98844938	unclassified	probably benign
R1510:Kmt2d	UTSW	15	98856377	unclassified	probably benign
R1586:Kmt2d	UTSW	15	98865053	splice site	probably benign
R1640:Kmt2d	UTSW	15	98845057	unclassified	probably benign
R1714:Kmt2d	UTSW	15	98862950	missense	unknown
R1725:Kmt2d	UTSW	15	98845234	unclassified	probably benign
R1728:Kmt2d	UTSW	15	98865132	missense	probably damaging	1.00
R1729:Kmt2d	UTSW	15	98865132	missense	probably damaging	1.00
R1741:Kmt2d	UTSW	15	98845234	unclassified	probably benign
R1744:Kmt2d	UTSW	15	98865047	missense	probably damaging	0.99
R1746:Kmt2d	UTSW	15	98864378	missense	probably damaging	0.97
R1753:Kmt2d	UTSW	15	98843482	unclassified	probably benign
R1782:Kmt2d	UTSW	15	98857548	unclassified	probably benign
R1789:Kmt2d	UTSW	15	98852074	unclassified	probably benign
R1802:Kmt2d	UTSW	15	98862985	missense	unknown
R1808:Kmt2d	UTSW	15	98866686	missense	probably damaging	1.00
R1822:Kmt2d	UTSW	15	98861780	missense	unknown
R1831:Kmt2d	UTSW	15	98855343	missense	probably damaging	0.97
R1920:Kmt2d	UTSW	15	98855590	missense	probably damaging	0.96
R1920:Kmt2d	UTSW	15	98855591	missense	probably damaging	1.00
R1956:Kmt2d	UTSW	15	98859590	unclassified	probably benign
R2100:Kmt2d	UTSW	15	98846480	unclassified	probably benign
R2120:Kmt2d	UTSW	15	98839529	unclassified	probably benign
R2188:Kmt2d	UTSW	15	98839300	unclassified	probably benign
R2191:Kmt2d	UTSW	15	98861049	critical splice donor site	probably null
R2234:Kmt2d	UTSW	15	98865248	missense	probably damaging	0.98
R2422:Kmt2d	UTSW	15	98862266	missense	unknown
R2762:Kmt2d	UTSW	15	98852055	unclassified	probably benign
R2895:Kmt2d	UTSW	15	98843939	unclassified	probably benign
R3624:Kmt2d	UTSW	15	98842902	unclassified	probably benign
R3791:Kmt2d	UTSW	15	98844149	unclassified	probably benign
R3794:Kmt2d	UTSW	15	98837359	unclassified	probably benign
R3958:Kmt2d	UTSW	15	98855549	missense	possibly damaging	0.69
R3983:Kmt2d	UTSW	15	98846046	unclassified	probably benign
R4211:Kmt2d	UTSW	15	98840189	unclassified	probably benign
R4212:Kmt2d	UTSW	15	98845003	unclassified	probably benign
R4240:Kmt2d	UTSW	15	98844571	unclassified	probably benign
R4246:Kmt2d	UTSW	15	98840089	unclassified	probably benign
R4361:Kmt2d	UTSW	15	98863670	missense	unknown
R4388:Kmt2d	UTSW	15	98853626	unclassified	probably benign
R4602:Kmt2d	UTSW	15	98850259	unclassified	probably benign
R4606:Kmt2d	UTSW	15	98839716	unclassified	probably benign
R4658:Kmt2d	UTSW	15	98852529	unclassified	probably benign
R4840:Kmt2d	UTSW	15	98861894	missense	unknown
R4895:Kmt2d	UTSW	15	98844487	unclassified	probably benign
R4906:Kmt2d	UTSW	15	98849539	unclassified	probably benign
R4976:Kmt2d	UTSW	15	98847194	utr 3 prime	probably benign
R5093:Kmt2d	UTSW	15	98856162	missense	probably damaging	1.00
R5119:Kmt2d	UTSW	15	98847194	utr 3 prime	probably benign
R5160:Kmt2d	UTSW	15	98840224	unclassified	probably benign
R5260:Kmt2d	UTSW	15	98842860	unclassified	probably benign
R5274:Kmt2d	UTSW	15	98854230	unclassified	probably benign
R5450:Kmt2d	UTSW	15	98855086	missense	probably damaging	1.00
R5461:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5462:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5463:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5465:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5467:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5481:Kmt2d	UTSW	15	98862005	missense	unknown
R5509:Kmt2d	UTSW	15	98839676	unclassified	probably benign
R5534:Kmt2d	UTSW	15	98837357	unclassified	probably benign
R5536:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5537:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5538:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5546:Kmt2d	UTSW	15	98853068	unclassified	probably benign
R5595:Kmt2d	UTSW	15	98850024	unclassified	probably benign
R5645:Kmt2d	UTSW	15	98844397	unclassified	probably benign
R5679:Kmt2d	UTSW	15	98854272	unclassified	probably benign
R5710:Kmt2d	UTSW	15	98854106	unclassified	probably benign
R5755:Kmt2d	UTSW	15	98863646	missense	unknown
R5817:Kmt2d	UTSW	15	98862363	missense	unknown
R5841:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5842:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5843:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5844:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R5845:Kmt2d	UTSW	15	98852109	unclassified	probably benign
R6122:Kmt2d	UTSW	15	98860692	unclassified	probably benign
R6612:Kmt2d	UTSW	15	98845858	unclassified	probably benign
R6718:Kmt2d	UTSW	15	98849586	unclassified	probably benign
R6718:Kmt2d	UTSW	15	98850539	unclassified	probably benign
R6822:Kmt2d	UTSW	15	98849459	unclassified	probably benign
R6866:Kmt2d	UTSW	15	98857393	unclassified	probably benign
R6950:Kmt2d	UTSW	15	98840020	unclassified	probably benign
X0018:Kmt2d	UTSW	15	98852922	unclassified	probably benign
X0024:Kmt2d	UTSW	15	98853053	unclassified	probably benign
X0062:Kmt2d	UTSW	15	98849819	unclassified	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAACTCGATGAACTGAGCAG -3'
(R):5'- GTTCCTCACTAGCCTAAGCC -3'

Sequencing Primer
(F):5'- TGAACTGAGCAGGGCCAGC -3'
(R):5'- GACTACTGCATATTTTTCCAGGCAAC -3'

Posted On

2015-04-06