Incidental Mutation 'R3871:Ubxn7'
ID276580
Institutional Source Beutler Lab
Gene Symbol Ubxn7
Ensembl Gene ENSMUSG00000053774
Gene NameUBX domain protein 7
SynonymsUbxd7
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.311) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32332257-32393747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32381430 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 335 (S335T)
Ref Sequence ENSEMBL: ENSMUSP00000110804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115151] [ENSMUST00000232137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000115151
AA Change: S335T

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110804
Gene: ENSMUSG00000053774
AA Change: S335T

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:UBA_4 15 56 4.3e-15 PFAM
UAS 137 260 3.05e-50 SMART
low complexity region 312 328 N/A INTRINSIC
UBX 405 487 1.16e-15 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000232137
AA Change: S313T

PolyPhen 2 Score 0.543 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Ubxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Ubxn7 APN 16 32369398 missense probably damaging 0.97
IGL02149:Ubxn7 APN 16 32375270 missense probably damaging 1.00
IGL02183:Ubxn7 APN 16 32369383 missense probably damaging 1.00
IGL02690:Ubxn7 APN 16 32381605 missense probably benign 0.01
IGL03133:Ubxn7 APN 16 32381781 missense probably damaging 1.00
R0268:Ubxn7 UTSW 16 32360046 missense probably benign 0.05
R0583:Ubxn7 UTSW 16 32375914 missense probably damaging 1.00
R0635:Ubxn7 UTSW 16 32367417 intron probably benign
R0787:Ubxn7 UTSW 16 32381763 splice site probably benign
R1658:Ubxn7 UTSW 16 32381236 intron probably null
R1916:Ubxn7 UTSW 16 32381759 splice site probably benign
R2070:Ubxn7 UTSW 16 32372469 missense possibly damaging 0.47
R2071:Ubxn7 UTSW 16 32372469 missense possibly damaging 0.47
R3031:Ubxn7 UTSW 16 32375307 missense probably benign 0.34
R4994:Ubxn7 UTSW 16 32381504 missense probably damaging 1.00
R5629:Ubxn7 UTSW 16 32332299 missense unknown
R6334:Ubxn7 UTSW 16 32372189 unclassified probably null
R6599:Ubxn7 UTSW 16 32384925 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGGAGAGCCTCATAGATGC -3'
(R):5'- GCAAGTCATTCAGTACGTTCGAG -3'

Sequencing Primer
(F):5'- CTCATAGATGCTAGTGAAGACAGCC -3'
(R):5'- GACTTTTCAGGTGACATCTCCAAGAC -3'
Posted On2015-04-06