Incidental Mutation 'R3871:Usp14'
ID276584
Institutional Source Beutler Lab
Gene Symbol Usp14
Ensembl Gene ENSMUSG00000047879
Gene Nameubiquitin specific peptidase 14
Synonyms2610005K12Rik, ataxia, NMF375, nmf375, dUB-type TGT, ax, 2610037B11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location9995432-10045119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10002370 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 314 (S314P)
Ref Sequence ENSEMBL: ENSMUSP00000089728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092096] [ENSMUST00000116669]
PDB Structure
Solution Structure of the N-terminal Ubiquitin-like Domain of Mouse Ubiquitin Specific Protease 14 (USP14) [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092096
AA Change: S314P

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000089728
Gene: ENSMUSG00000047879
AA Change: S314P

DomainStartEndE-ValueType
UBQ 4 74 3.61e-11 SMART
Pfam:UCH 104 479 9e-57 PFAM
Pfam:UCH_1 105 456 3.2e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116669
AA Change: S279P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112368
Gene: ENSMUSG00000047879
AA Change: S279P

DomainStartEndE-ValueType
UBQ 4 73 2.63e-4 SMART
low complexity region 217 235 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133594
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154088
Meta Mutation Damage Score 0.364 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ubiquitin-specific processing (UBP) family of proteases that is a deubiquitinating enzyme (DUB) with His and Cys domains. This protein is located in the cytoplasm and cleaves the ubiquitin moiety from ubiquitin-fused precursors and ubiquitinylated proteins. Mice with a mutation that results in reduced expression of the ortholog of this protein are retarded for growth, develop severe tremors by 2 to 3 weeks of age followed by hindlimb paralysis and death by 6 to 10 weeks of age. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a hypomorphic mutation develop severe tremors by 3 weeks of age, followed by hindlimb paralysis and premature death. An underdeveloped corpus callosum, hippocampus, dentate gyrus and forebrain structures, and notable defects in synaptic transmission in both the CNS and PNS are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh1a1 T A 19: 20,624,753 Y225* probably null Het
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Usp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02671:Usp14 APN 18 9997196 missense probably damaging 0.99
IGL02756:Usp14 APN 18 10001769 critical splice donor site probably null
R1238:Usp14 UTSW 18 9997763 missense probably benign
R1343:Usp14 UTSW 18 10016623 missense probably benign 0.03
R1365:Usp14 UTSW 18 10000490 splice site probably null
R1495:Usp14 UTSW 18 10004994 missense probably benign 0.01
R1817:Usp14 UTSW 18 10024673 missense probably damaging 1.00
R2021:Usp14 UTSW 18 10024632 missense probably damaging 0.99
R2190:Usp14 UTSW 18 10007835 missense probably damaging 1.00
R3836:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3837:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3838:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3839:Usp14 UTSW 18 10024532 critical splice donor site probably null
R3870:Usp14 UTSW 18 10002370 missense possibly damaging 0.89
R5388:Usp14 UTSW 18 10018023 missense probably damaging 1.00
R5767:Usp14 UTSW 18 10009935 intron probably benign
R5871:Usp14 UTSW 18 9996234 missense probably benign 0.27
R5898:Usp14 UTSW 18 10022819 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GAGTCACTGCTCCAACCAG -3'
(R):5'- GCAACATTGTATTCAGAGCCTTTTAA -3'

Sequencing Primer
(F):5'- CAGCACCCTGGGATTAGAGAC -3'
(R):5'- GTCAGTCTCTGTGAGCTCCTATAAG -3'
Posted On2015-04-06