Incidental Mutation 'R3871:Aldh1a1'
ID276585
Institutional Source Beutler Lab
Gene Symbol Aldh1a1
Ensembl Gene ENSMUSG00000053279
Gene Namealdehyde dehydrogenase family 1, subfamily A1
SynonymsAhd-2, Ahd2, ALDH1, Raldh1, E1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R3871 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location20492715-20643462 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 20624753 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 225 (Y225*)
Ref Sequence ENSEMBL: ENSMUSP00000084918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087638] [ENSMUST00000225313] [ENSMUST00000225337]
Predicted Effect probably null
Transcript: ENSMUST00000087638
AA Change: Y225*
SMART Domains Protein: ENSMUSP00000084918
Gene: ENSMUSG00000053279
AA Change: Y225*

DomainStartEndE-ValueType
Pfam:Aldedh 29 492 5.1e-185 PFAM
Pfam:LuxC 147 368 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000225313
Predicted Effect probably benign
Transcript: ENSMUST00000225337
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a disruption in this gene show a significantly reduced ability to convert retinol to retinoic acid in the liver. Retinal morphology is normal even though the gene is normally highly expressed in the dorsal retina. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bard1 T C 1: 71,074,940 K294R probably benign Het
Bcap29 A T 12: 31,617,081 S194T probably benign Het
Ccdc40 G A 11: 119,264,281 V1116M probably damaging Het
Cntnap5a A G 1: 116,060,249 E170G probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp2c54 T C 19: 40,072,423 D92G probably benign Het
Dpp6 T C 5: 27,469,465 F197L probably benign Het
Filip1l G T 16: 57,513,286 K147N probably damaging Het
Hrnr T A 3: 93,331,874 S3140T unknown Het
Igfn1 G T 1: 135,968,836 H1331N probably benign Het
Kalrn C T 16: 34,203,856 probably null Het
Kmt2d TTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGC 15: 98,851,021 probably benign Het
Mfng A G 15: 78,756,621 L308P probably damaging Het
Nt5e C A 9: 88,364,693 N327K probably benign Het
Olfr1025-ps1 T G 2: 85,918,582 probably null Het
Pgbd1 C T 13: 21,434,370 R39H possibly damaging Het
Phactr4 T C 4: 132,377,249 T256A probably benign Het
Rab24 T C 13: 55,321,179 D63G probably damaging Het
Rubcnl C T 14: 75,040,916 P380L probably benign Het
Satb2 A G 1: 56,891,220 S215P probably damaging Het
Serpina3b A T 12: 104,138,788 I408F probably damaging Het
Setx A G 2: 29,145,741 D746G probably damaging Het
Sf3a2 A C 10: 80,804,693 probably benign Het
Snx33 T C 9: 56,926,740 N15S probably benign Het
Snx9 C T 17: 5,891,781 P61L probably benign Het
Sult2a6 T C 7: 14,254,776 K20E probably benign Het
Tas2r122 A G 6: 132,711,580 S117P probably benign Het
Tmem26 G A 10: 68,778,732 E326K probably benign Het
Tnpo2 T A 8: 85,054,751 C789S probably null Het
Togaram1 A C 12: 65,002,645 E1285D probably benign Het
Ubxn7 T A 16: 32,381,430 S335T possibly damaging Het
Unc119b G A 5: 115,130,508 T106M probably damaging Het
Usp14 A G 18: 10,002,370 S314P possibly damaging Het
Usp32 T C 11: 85,081,156 D129G probably null Het
Other mutations in Aldh1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Aldh1a1 APN 19 20619997 missense probably benign 0.13
IGL01769:Aldh1a1 APN 19 20642919 missense probably benign 0.29
IGL02745:Aldh1a1 APN 19 20636664 splice site probably benign
IGL02989:Aldh1a1 APN 19 20640058 splice site probably benign
IGL03154:Aldh1a1 APN 19 20630768 missense probably benign 0.21
LCD18:Aldh1a1 UTSW 19 20626646 intron probably benign
R0265:Aldh1a1 UTSW 19 20640076 nonsense probably null
R0282:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0418:Aldh1a1 UTSW 19 20629049 splice site probably benign
R0471:Aldh1a1 UTSW 19 20602013 start codon destroyed probably null 0.99
R0556:Aldh1a1 UTSW 19 20634478 missense probably damaging 1.00
R0755:Aldh1a1 UTSW 19 20617994 missense probably benign
R1164:Aldh1a1 UTSW 19 20617946 missense probably benign 0.11
R1692:Aldh1a1 UTSW 19 20630818 missense probably damaging 1.00
R1905:Aldh1a1 UTSW 19 20617998 missense probably damaging 1.00
R2127:Aldh1a1 UTSW 19 20642915 missense probably benign 0.00
R2281:Aldh1a1 UTSW 19 20620091 missense possibly damaging 0.88
R2475:Aldh1a1 UTSW 19 20640078 missense probably benign
R4607:Aldh1a1 UTSW 19 20621687 missense probably benign 0.35
R4725:Aldh1a1 UTSW 19 20640081 missense probably benign
R4791:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4792:Aldh1a1 UTSW 19 20619985 missense probably damaging 0.99
R4844:Aldh1a1 UTSW 19 20634400 missense probably benign 0.00
R5639:Aldh1a1 UTSW 19 20623422 missense probably damaging 1.00
R5669:Aldh1a1 UTSW 19 20610920 missense probably damaging 1.00
R5815:Aldh1a1 UTSW 19 20630670 missense probably benign 0.00
R6387:Aldh1a1 UTSW 19 20617959 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCCTTTGAGTACGTCTTCATATAAAC -3'
(R):5'- GCAACAGGTATCTTCTTTGATCC -3'

Sequencing Primer
(F):5'- GTTTCAGTAACGTACCCAA -3'
(R):5'- GATCCTAAATTCATCCAGCTGTG -3'
Posted On2015-04-06