Incidental Mutation 'R3872:Myo1g'
ID276624
Institutional Source Beutler Lab
Gene Symbol Myo1g
Ensembl Gene ENSMUSG00000020437
Gene Namemyosin IG
Synonyms
MMRRC Submission 040790-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3872 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6506548-6520965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 6514886 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 463 (V463I)
Ref Sequence ENSEMBL: ENSMUSP00000003459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003459] [ENSMUST00000134489] [ENSMUST00000144725] [ENSMUST00000146536]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003459
AA Change: V463I

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003459
Gene: ENSMUSG00000020437
AA Change: V463I

DomainStartEndE-ValueType
MYSc 9 714 N/A SMART
IQ 715 737 2.79e0 SMART
Pfam:Myosin_TH1 821 1024 2.8e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131823
Predicted Effect probably benign
Transcript: ENSMUST00000134489
SMART Domains Protein: ENSMUSP00000122356
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Pfam:Myosin_head 51 99 5.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144725
SMART Domains Protein: ENSMUSP00000120975
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Blast:MYSc 9 43 8e-14 BLAST
low complexity region 48 60 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146536
SMART Domains Protein: ENSMUSP00000122438
Gene: ENSMUSG00000020437

DomainStartEndE-ValueType
Blast:MYSc 9 38 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156878
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MYO1G is a plasma membrane-associated class I myosin (see MIM 601478) that is abundant in T and B lymphocytes and mast cells (Pierce et al., 2001 [PubMed 11544309]; Patino-Lopez et al., 2010 [PubMed 20071333]).[supplied by OMIM, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced B cell spreading, migration and homing and impaired T cell motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk T C 11: 120,010,219 E1117G possibly damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
BC055324 A T 1: 163,986,964 S137T probably damaging Het
Bhmt-ps1 T C 4: 26,369,201 noncoding transcript Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cic T C 7: 25,271,699 V285A possibly damaging Het
Col19a1 A G 1: 24,575,327 probably benign Het
Col6a4 T C 9: 106,013,659 N1812S possibly damaging Het
Cry1 T C 10: 85,133,160 probably null Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dlx5 G T 6: 6,878,209 P274T probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnah5 A G 15: 28,411,510 K3675R possibly damaging Het
Dpp6 A G 5: 27,721,058 Y710C probably damaging Het
Dsc3 C A 18: 19,971,508 K587N probably damaging Het
Epcam C A 17: 87,639,926 T36K possibly damaging Het
Epha2 T C 4: 141,308,405 W51R probably damaging Het
Eya4 A T 10: 23,155,972 I251N probably damaging Het
Fbxo21 G A 5: 118,000,329 V447I possibly damaging Het
Frg2f1 T A 4: 119,530,958 T115S possibly damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hecw2 A T 1: 53,832,757 probably benign Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Iqca A T 1: 90,089,481 Y411N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt34 T C 11: 100,041,417 H27R probably benign Het
Mia3 T C 1: 183,356,998 E791G probably benign Het
Mroh2b A T 15: 4,925,061 K669* probably null Het
Msmo1 C T 8: 64,722,463 probably null Het
Muc6 T C 7: 141,640,600 T1387A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr192 G A 16: 59,098,761 T77I unknown Het
Pde10a C A 17: 8,757,091 T16K possibly damaging Het
Pfas T C 11: 69,000,263 T310A probably damaging Het
Phb2 G A 6: 124,716,431 probably null Het
Plin3 A G 17: 56,284,181 S200P probably damaging Het
Plxna1 C A 6: 89,332,692 E1087* probably null Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Sacs C T 14: 61,148,068 T6M probably benign Het
Scfd1 A G 12: 51,392,196 Y147C probably damaging Het
Sept1 T C 7: 127,215,275 probably benign Het
Sept5 A G 16: 18,622,973 L344P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc35f1 A G 10: 53,021,910 D139G possibly damaging Het
Sod3 A G 5: 52,368,289 Y110C probably damaging Het
Stk35 T C 2: 129,810,575 V332A possibly damaging Het
Tacc2 C T 7: 130,622,422 T279M probably benign Het
Tdo2 T C 3: 81,968,086 E187G probably benign Het
Tmem150b A T 7: 4,724,361 Y48* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r60 C T 7: 42,136,454 S227L probably benign Het
Vps33a C T 5: 123,531,192 V549I probably benign Het
Zfp788 T A 7: 41,649,444 Y449* probably null Het
Other mutations in Myo1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Myo1g APN 11 6515856 missense possibly damaging 0.70
IGL01608:Myo1g APN 11 6516780 missense possibly damaging 0.61
IGL01679:Myo1g APN 11 6518006 missense possibly damaging 0.90
IGL01830:Myo1g APN 11 6514522 nonsense probably null
IGL02332:Myo1g APN 11 6520766 missense possibly damaging 0.61
IGL02813:Myo1g APN 11 6518743 makesense probably null
IGL02988:Myo1g APN 11 6508183 splice site probably benign
IGL03178:Myo1g APN 11 6512181 missense probably damaging 1.00
R0004:Myo1g UTSW 11 6515901 missense probably damaging 1.00
R0334:Myo1g UTSW 11 6511084 splice site probably benign
R0513:Myo1g UTSW 11 6510203 missense probably benign 0.00
R0730:Myo1g UTSW 11 6520794 missense probably damaging 1.00
R1054:Myo1g UTSW 11 6518987 missense probably damaging 1.00
R1434:Myo1g UTSW 11 6509372 missense probably benign 0.00
R1500:Myo1g UTSW 11 6520811 missense probably benign
R1513:Myo1g UTSW 11 6515140 missense probably damaging 0.99
R1720:Myo1g UTSW 11 6512490 missense probably benign 0.44
R1774:Myo1g UTSW 11 6515988 missense probably damaging 1.00
R1809:Myo1g UTSW 11 6512283 missense probably benign 0.02
R1957:Myo1g UTSW 11 6512159 critical splice donor site probably null
R1978:Myo1g UTSW 11 6520829 missense possibly damaging 0.53
R2212:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R2438:Myo1g UTSW 11 6511542 missense probably damaging 1.00
R2566:Myo1g UTSW 11 6512539 critical splice acceptor site probably null
R3158:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3159:Myo1g UTSW 11 6514527 missense possibly damaging 0.62
R3413:Myo1g UTSW 11 6517870 missense possibly damaging 0.88
R3816:Myo1g UTSW 11 6510926 missense probably benign 0.02
R3946:Myo1g UTSW 11 6520760 missense possibly damaging 0.89
R4551:Myo1g UTSW 11 6517874 missense probably damaging 1.00
R4625:Myo1g UTSW 11 6512240 missense probably damaging 1.00
R4630:Myo1g UTSW 11 6519047 missense probably damaging 1.00
R4700:Myo1g UTSW 11 6516785 unclassified probably null
R4713:Myo1g UTSW 11 6516080 missense probably null 1.00
R4964:Myo1g UTSW 11 6515976 missense probably damaging 1.00
R5183:Myo1g UTSW 11 6508243 missense probably damaging 1.00
R5191:Myo1g UTSW 11 6515105 missense probably benign
R5192:Myo1g UTSW 11 6514816 missense probably damaging 1.00
R5726:Myo1g UTSW 11 6509420 missense probably benign 0.06
R5841:Myo1g UTSW 11 6507000 missense probably benign 0.05
R5942:Myo1g UTSW 11 6514888 missense probably damaging 1.00
R6225:Myo1g UTSW 11 6519168 missense probably damaging 1.00
R6517:Myo1g UTSW 11 6512509 missense probably damaging 0.99
R6563:Myo1g UTSW 11 6517146 missense possibly damaging 0.91
X0017:Myo1g UTSW 11 6516077 critical splice donor site probably null
X0061:Myo1g UTSW 11 6517967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATCGGAACCTGTCTGTG -3'
(R):5'- TGCAGCAGCTCTTTATCCAG -3'

Sequencing Primer
(F):5'- ATCGGAACCTGTCTGTGTGTCC -3'
(R):5'- AGCTCTTTATCCAGCTTATCCTGAAG -3'
Posted On2015-04-06