Incidental Mutation 'R3873:Scyl3'
ID276648
Institutional Source Beutler Lab
Gene Symbol Scyl3
Ensembl Gene ENSMUSG00000026584
Gene NameSCY1-like 3 (S. cerevisiae)
Synonyms1200016D23Rik, Pace1
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location163929100-163955126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163950637 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 448 (N448S)
Ref Sequence ENSEMBL: ENSMUSP00000132109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027876] [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000159516] [ENSMUST00000159617] [ENSMUST00000161908] [ENSMUST00000162234] [ENSMUST00000170359]
Predicted Effect probably benign
Transcript: ENSMUST00000027876
AA Change: N461S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027876
Gene: ENSMUSG00000026584
AA Change: N461S

DomainStartEndE-ValueType
Pfam:Pkinase 32 245 1.9e-7 PFAM
low complexity region 525 541 N/A INTRINSIC
low complexity region 711 731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000045876
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097493
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159516
Predicted Effect probably benign
Transcript: ENSMUST00000159617
Predicted Effect probably benign
Transcript: ENSMUST00000161908
AA Change: N448S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125735
Gene: ENSMUSG00000026584
AA Change: N448S

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162920
Predicted Effect probably benign
Transcript: ENSMUST00000170359
AA Change: N448S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132109
Gene: ENSMUSG00000026584
AA Change: N448S

DomainStartEndE-ValueType
Pfam:Pkinase 25 274 1.5e-8 PFAM
low complexity region 512 528 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a kinase domain and four HEAT repeats. The encoded protein interacts with the C-terminal domain of ezrin, an ERM protein, and may play a role in cell adhesion and migration. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Scyl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Scyl3 APN 1 163934769 nonsense probably null
IGL03410:Scyl3 APN 1 163944867 missense probably damaging 1.00
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R0017:Scyl3 UTSW 1 163939969 missense possibly damaging 0.53
R1138:Scyl3 UTSW 1 163933665 missense possibly damaging 0.47
R1363:Scyl3 UTSW 1 163950690 missense probably benign 0.01
R1564:Scyl3 UTSW 1 163939984 critical splice donor site probably null
R1843:Scyl3 UTSW 1 163950675 missense probably benign
R1856:Scyl3 UTSW 1 163933696 splice site probably null
R4018:Scyl3 UTSW 1 163936499 missense possibly damaging 0.83
R4746:Scyl3 UTSW 1 163949251 missense probably damaging 1.00
R4940:Scyl3 UTSW 1 163934747 missense probably damaging 1.00
R5408:Scyl3 UTSW 1 163954676 utr 3 prime probably null
R6125:Scyl3 UTSW 1 163950576 missense probably benign
R6268:Scyl3 UTSW 1 163946217 nonsense probably null
R6374:Scyl3 UTSW 1 163949214 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- TTTAACCTCAGGAGACAGGAAACC -3'
(R):5'- AACTGTTTGGAGAGGTCAGAC -3'

Sequencing Primer
(F):5'- GGAGACAGGAAACCCATTTAATAATG -3'
(R):5'- CTGTTTGGAGAGGTCAGACAAGAC -3'
Posted On2015-04-06