Incidental Mutation 'R3873:1700007G11Rik'
List |< first << previous [record 72 of 55675] next >> last >|
ID276662
Institutional Source Beutler Lab
Gene Symbol 1700007G11Rik
Ensembl Gene ENSMUSG00000057816
Gene NameRIKEN cDNA 1700007G11 gene
Synonyms
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location98329304-98802047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98737623 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 130 (I130F)
Ref Sequence ENSEMBL: ENSMUSP00000079208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080333]
Predicted Effect probably damaging
Transcript: ENSMUST00000080333
AA Change: I130F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079208
Gene: ENSMUSG00000057816
AA Change: I130F

DomainStartEndE-ValueType
Pfam:DUF4464 12 232 7.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196339
Meta Mutation Damage Score 0.178 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in 1700007G11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:1700007G11Rik APN 5 98784510 missense probably benign 0.00
IGL01133:1700007G11Rik APN 5 98498381 critical splice donor site probably null
IGL02151:1700007G11Rik APN 5 98329442 missense probably damaging 1.00
LCD18:1700007G11Rik UTSW 5 98707508 intron probably benign
R0962:1700007G11Rik UTSW 5 98566561 intron probably benign
R1545:1700007G11Rik UTSW 5 98329432 missense probably benign 0.25
R1886:1700007G11Rik UTSW 5 98801831 missense probably benign 0.41
R1954:1700007G11Rik UTSW 5 98566753 intron probably benign
R1965:1700007G11Rik UTSW 5 98346234 missense probably damaging 1.00
R2008:1700007G11Rik UTSW 5 98737702 missense possibly damaging 0.90
R4940:1700007G11Rik UTSW 5 98737636 missense possibly damaging 0.95
R5708:1700007G11Rik UTSW 5 98737707 missense probably benign
R6509:1700007G11Rik UTSW 5 98329397 missense probably benign 0.16
R6595:1700007G11Rik UTSW 5 98801858 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACCTACCTGAGATAATCATGGGTG -3'
(R):5'- CCAACAGTTATCCATTGCCAGC -3'

Sequencing Primer
(F):5'- GTGAAACATACAGCAGCACTTG -3'
(R):5'- AGTTATCCATTGCCAGCCTCAC -3'
Posted On2015-04-06