Incidental Mutation 'R3873:Taar1'
ID276671
Institutional Source Beutler Lab
Gene Symbol Taar1
Ensembl Gene ENSMUSG00000056379
Gene Nametrace amine-associated receptor 1
SynonymsTrar1, Tar1
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23920356-23921469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23920584 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 60 (L60P)
Ref Sequence ENSEMBL: ENSMUSP00000049527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051532]
Predicted Effect probably damaging
Transcript: ENSMUST00000051532
AA Change: L60P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049527
Gene: ENSMUSG00000056379
AA Change: L60P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 316 1.4e-11 PFAM
Pfam:7tm_1 39 301 2.4e-62 PFAM
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G-protein coupled receptor activated by trace amines. The encoded protein responds little or not at all to dopamine, serotonin, epinephrine, or histamine, but responds well to beta-phenylethylamine, p-tyramine, octopamine, and tryptamine. While primarily functioning in neurologic systems, there is evidence that this gene is involved in blood cell and immunologic functions as well. This gene is thought to be intronless. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null mutation display decreased prepulse inhibition and increased sensitivity to amphetamines. Mice homozygous for another knock-out allele exhibit increased sensitivity to MDMA-induced hyperthermia, brain dopamine and serotonin levels, and induced hyperactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Taar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Taar1 APN 10 23920446 missense probably benign 0.00
R0022:Taar1 UTSW 10 23920727 missense probably benign 0.45
R0126:Taar1 UTSW 10 23920547 missense probably benign 0.00
R0442:Taar1 UTSW 10 23920482 missense possibly damaging 0.80
R0720:Taar1 UTSW 10 23921073 missense probably damaging 1.00
R0931:Taar1 UTSW 10 23921283 missense probably damaging 1.00
R1270:Taar1 UTSW 10 23920533 missense probably damaging 1.00
R1834:Taar1 UTSW 10 23921189 missense probably benign 0.04
R2137:Taar1 UTSW 10 23921270 missense probably benign
R3765:Taar1 UTSW 10 23921307 missense probably damaging 1.00
R5334:Taar1 UTSW 10 23920545 missense probably damaging 1.00
R5418:Taar1 UTSW 10 23921316 missense possibly damaging 0.91
R5578:Taar1 UTSW 10 23920820 missense possibly damaging 0.71
R7048:Taar1 UTSW 10 23920824 missense probably benign 0.40
R7096:Taar1 UTSW 10 23920911 missense possibly damaging 0.48
R7163:Taar1 UTSW 10 23921020 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AAAGCCCAGCCTGTGTCTAG -3'
(R):5'- CAGCACAGTAGCGGTCAATG -3'

Sequencing Primer
(F):5'- AGTTCTCTGCAGTGATGCATC -3'
(R):5'- CACAGTAGCGGTCAATGGAAATG -3'
Posted On2015-04-06