Incidental Mutation 'R3873:Sgsh'
ID276680
Institutional Source Beutler Lab
Gene Symbol Sgsh
Ensembl Gene ENSMUSG00000005043
Gene NameN-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonymssulphamidase, 4632406A19Rik
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R3873 (G1)
Quality Score159
Status Validated
Chromosome11
Chromosomal Location119343425-119355536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119350947 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 111 (L111P)
Ref Sequence ENSEMBL: ENSMUSP00000097748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005173] [ENSMUST00000050880] [ENSMUST00000100172] [ENSMUST00000136523]
Predicted Effect probably damaging
Transcript: ENSMUST00000005173
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005173
Gene: ENSMUSG00000005043
AA Change: L111P

DomainStartEndE-ValueType
Pfam:Sulfatase 23 328 2.6e-60 PFAM
Pfam:Phosphodiest 25 287 5.2e-8 PFAM
low complexity region 348 357 N/A INTRINSIC
Pfam:DUF4976 400 477 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050880
SMART Domains Protein: ENSMUSP00000050999
Gene: ENSMUSG00000039908

DomainStartEndE-ValueType
Pfam:Sulfate_transp 31 424 1.8e-97 PFAM
transmembrane domain 426 448 N/A INTRINSIC
Pfam:STAS 453 559 3.6e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100172
AA Change: L111P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097748
Gene: ENSMUSG00000005043
AA Change: L111P

DomainStartEndE-ValueType
Pfam:Sulfatase 23 250 1.7e-35 PFAM
Pfam:Phosphodiest 25 237 2.7e-8 PFAM
low complexity region 311 329 N/A INTRINSIC
low complexity region 395 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133507
Predicted Effect probably damaging
Transcript: ENSMUST00000136523
AA Change: S84P

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115587
Gene: ENSMUSG00000005043
AA Change: S84P

DomainStartEndE-ValueType
PDB:4MIV|H 1 30 1e-5 PDB
low complexity region 40 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147366
Meta Mutation Damage Score 0.514 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several enzymes involved in the lysosomal degradation of heparan sulfate. Mutations in this gene are associated with Sanfilippo syndrome A, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. Transcripts of varying sizes have been reported but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele die prematurely displaying low sulfamidase activity, variable lysosomal storage in various brain cell types and other tissues, heparan sulfate-uria, scruffy coats, corneal opacities, bladder distension, hydronephrosis, hepatosplenomegaly and bone deformities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Arvcf G A 16: 18,403,033 R736Q probably damaging Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Sgsh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Sgsh APN 11 119346485 missense probably benign
IGL01549:Sgsh APN 11 119350929 missense probably damaging 0.99
IGL02110:Sgsh APN 11 119352806 missense probably damaging 1.00
IGL02878:Sgsh APN 11 119346558 missense probably damaging 1.00
R1187:Sgsh UTSW 11 119346578 nonsense probably null
R2342:Sgsh UTSW 11 119347714 missense probably benign 0.01
R2472:Sgsh UTSW 11 119355474 missense possibly damaging 0.83
R2571:Sgsh UTSW 11 119350514 missense probably damaging 1.00
R3872:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3874:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R3875:Sgsh UTSW 11 119350947 missense probably damaging 1.00
R5075:Sgsh UTSW 11 119346768 missense probably benign 0.34
R5660:Sgsh UTSW 11 119350981 missense probably damaging 1.00
R5938:Sgsh UTSW 11 119346799 missense probably benign 0.08
R7302:Sgsh UTSW 11 119347699 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACAAAGTGGCCTTGCACCTG -3'
(R):5'- TTACAGAGACAGGGCCTAGG -3'

Sequencing Primer
(F):5'- ACCTGCATCCTGTCCTCAG -3'
(R):5'- AGCTCACTGTGCAGCTG -3'
Posted On2015-04-06