Incidental Mutation 'R3873:Arvcf'
ID276693
Institutional Source Beutler Lab
Gene Symbol Arvcf
Ensembl Gene ENSMUSG00000000325
Gene Namearmadillo repeat gene deleted in velocardiofacial syndrome
Synonyms
MMRRC Submission 040791-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3873 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location18348182-18407076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 18403033 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 736 (R736Q)
Ref Sequence ENSEMBL: ENSMUSP00000111278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000335] [ENSMUST00000090103] [ENSMUST00000115609] [ENSMUST00000115610] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000150253] [ENSMUST00000165430] [ENSMUST00000232025] [ENSMUST00000232241]
Predicted Effect probably benign
Transcript: ENSMUST00000000335
SMART Domains Protein: ENSMUSP00000000335
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 63 224 3.5e-24 PFAM
Pfam:Methyltransf_26 102 224 3.3e-9 PFAM
Pfam:Methyltransf_24 106 214 1.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090103
AA Change: R742Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325
AA Change: R742Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115609
SMART Domains Protein: ENSMUSP00000111272
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 63 224 3.5e-24 PFAM
Pfam:Methyltransf_26 102 224 3.3e-9 PFAM
Pfam:Methyltransf_24 106 214 1.2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115610
AA Change: R672Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111273
Gene: ENSMUSG00000000325
AA Change: R672Q

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
ARM 327 367 4.48e-7 SMART
ARM 370 411 3.31e-10 SMART
Blast:ARM 412 469 1e-20 BLAST
ARM 472 518 2.1e1 SMART
low complexity region 555 563 N/A INTRINSIC
ARM 582 623 9.55e1 SMART
ARM 629 669 4.05e-5 SMART
ARM 720 762 3.03e0 SMART
low complexity region 857 875 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115612
AA Change: R736Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325
AA Change: R736Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115613
AA Change: R742Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325
AA Change: R742Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115614
AA Change: R736Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325
AA Change: R736Q

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126183
Predicted Effect probably damaging
Transcript: ENSMUST00000150253
AA Change: R672Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155548
Predicted Effect probably benign
Transcript: ENSMUST00000165430
SMART Domains Protein: ENSMUSP00000130077
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 57 221 1.1e-22 PFAM
Pfam:Methyltransf_24 106 214 6.2e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231791
Predicted Effect probably damaging
Transcript: ENSMUST00000232025
AA Change: R678Q

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000232241
Meta Mutation Damage Score 0.0232 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Armadillo Repeat gene deleted in Velo-Cardio-Facial syndrome (ARVCF) is a member of the catenin family. This family plays an important role in the formation of adherens junction complexes, which are thought to facilitate communication between the inside and outside environments of a cell. The ARVCF gene was isolated in the search for the genetic defect responsible for the autosomal dominant Velo-Cardio-Facial syndrome (VCFS), a relatively common human disorder with phenotypic features including cleft palate, conotruncal heart defects and facial dysmorphology. The ARVCF gene encodes a protein containing two motifs, a coiled coil domain in the N-terminus and a 10 armadillo repeat sequence in the midregion. Since these sequences can facilitate protein-protein interactions ARVCF is thought to function in a protein complex. In addition, ARVCF contains a predicted nuclear-targeting sequence suggesting that it may have a function as a nuclear protein. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele display abnormal gait and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,737,623 I130F probably damaging Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acaca A G 11: 84,312,721 probably benign Het
Adam5 T C 8: 24,815,109 T110A probably benign Het
Agtpbp1 T C 13: 59,460,596 M175V possibly damaging Het
Akt1 T C 12: 112,656,533 N367S probably benign Het
Ankrd61 T A 5: 143,891,828 T67S probably damaging Het
Arl8a T C 1: 135,152,872 probably null Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cep295 A T 9: 15,333,365 V1265E probably damaging Het
Cyp2c29 A G 19: 39,329,144 D397G probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dst A G 1: 34,289,620 T4590A probably damaging Het
Fscb G T 12: 64,473,132 P520Q unknown Het
Gli1 T A 10: 127,331,356 N676I probably damaging Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Il7 A T 3: 7,604,164 V4D probably damaging Het
Itgae T A 11: 73,113,616 I243N probably damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Ly6g6e T C 17: 35,077,183 V10A probably benign Het
Morc3 G A 16: 93,862,436 V411I probably damaging Het
Mrpl32 G T 13: 14,613,045 probably benign Het
Ncald G A 15: 37,397,253 A61V probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1022 T A 2: 85,868,962 Y123* probably null Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Pgam5 T C 5: 110,265,599 Y210C probably damaging Het
Phf5a T C 15: 81,870,427 N50D probably benign Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Sacs A G 14: 61,192,286 K595R possibly damaging Het
Scyl3 A G 1: 163,950,637 N448S probably benign Het
Serpinb9g A T 13: 33,486,535 D2V probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Smg1 T C 7: 118,154,662 probably benign Het
Taar1 T C 10: 23,920,584 L60P probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Ubr4 T C 4: 139,423,990 V623A probably damaging Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vipr2 T C 12: 116,136,104 probably benign Het
Vmn2r16 T C 5: 109,340,311 M350T probably benign Het
Vmn2r22 T C 6: 123,637,380 E417G possibly damaging Het
Vmn2r9 C A 5: 108,847,835 V316F probably benign Het
Zfp53 C T 17: 21,508,631 P309S probably damaging Het
Other mutations in Arvcf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02155:Arvcf APN 16 18403900 missense probably damaging 1.00
IGL02901:Arvcf APN 16 18398242 missense probably damaging 0.99
IGL03218:Arvcf APN 16 18404125 splice site probably benign
IGL03239:Arvcf APN 16 18397067 missense probably damaging 1.00
PIT4466001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
PIT4472001:Arvcf UTSW 16 18402949 missense possibly damaging 0.91
R0045:Arvcf UTSW 16 18403458 missense probably benign 0.40
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0068:Arvcf UTSW 16 18396954 splice site probably benign
R0873:Arvcf UTSW 16 18400205 nonsense probably null
R1227:Arvcf UTSW 16 18389304 missense probably benign 0.00
R1495:Arvcf UTSW 16 18389386 missense probably damaging 0.96
R1717:Arvcf UTSW 16 18401569 missense possibly damaging 0.52
R2021:Arvcf UTSW 16 18399732 missense probably damaging 1.00
R4095:Arvcf UTSW 16 18401577 missense probably damaging 1.00
R4280:Arvcf UTSW 16 18397991 missense probably damaging 1.00
R4496:Arvcf UTSW 16 18405182 missense probably damaging 0.96
R4887:Arvcf UTSW 16 18398113 nonsense probably null
R5068:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5069:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5070:Arvcf UTSW 16 18398986 missense probably damaging 1.00
R5322:Arvcf UTSW 16 18397643 missense probably benign 0.00
R5400:Arvcf UTSW 16 18399070 missense probably benign 0.17
R6376:Arvcf UTSW 16 18405132 missense probably damaging 0.98
R6771:Arvcf UTSW 16 18403864 missense probably benign
R7106:Arvcf UTSW 16 18399049 missense probably damaging 0.99
R7176:Arvcf UTSW 16 18399727 missense probably damaging 1.00
R7202:Arvcf UTSW 16 18405198 missense probably damaging 1.00
Z1088:Arvcf UTSW 16 18402641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGCTCCATCTGGGCCAATG -3'
(R):5'- AGGTTGAGCCTCAGTGACTG -3'

Sequencing Primer
(F):5'- CATCTGGGCCAATGCGGTTG -3'
(R):5'- CTGGGGAAAGACCTAAGCCC -3'
Posted On2015-04-06