Incidental Mutation 'R3874:Dsg1c'
ID276761
Institutional Source Beutler Lab
Gene Symbol Dsg1c
Ensembl Gene ENSMUSG00000034774
Gene Namedesmoglein 1 gamma
SynonymsDsg6
MMRRC Submission 040792-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3874 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location20247340-20285031 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20277052 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 526 (I526V)
Ref Sequence ENSEMBL: ENSMUSP00000054799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054128]
Predicted Effect probably benign
Transcript: ENSMUST00000054128
AA Change: I526V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054799
Gene: ENSMUSG00000034774
AA Change: I526V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 1.7e-16 SMART
CA 179 267 5.2e-24 SMART
CA 290 384 4.5e-8 SMART
Blast:CA 407 488 8e-28 BLAST
low complexity region 491 500 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 545 553 N/A INTRINSIC
Pfam:Cadherin_C 611 732 5.2e-8 PFAM
low complexity region 737 750 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130213A22Rik C A 11: 69,121,475 G26* probably null Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Acox2 A G 14: 8,248,061 I407T probably benign Het
Adam8 T C 7: 139,987,607 N408D probably damaging Het
Adgre1 A T 17: 57,401,925 T39S probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Arid1b T A 17: 5,336,515 probably null Het
Atp2c2 A G 8: 119,735,296 I303V possibly damaging Het
Bpifc C T 10: 85,991,254 V144I probably benign Het
C530008M17Rik A G 5: 76,840,892 D30G probably damaging Het
Camk4 A G 18: 33,158,854 E189G possibly damaging Het
Casz1 A G 4: 148,939,589 probably benign Het
Ccdc134 T C 15: 82,131,442 V41A possibly damaging Het
Chrd A T 16: 20,738,910 T753S probably damaging Het
Cyb561a3 T C 19: 10,585,371 V125A probably benign Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dchs1 A G 7: 105,761,635 F1687S probably damaging Het
Dlgap4 T C 2: 156,749,347 S818P probably benign Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Dnaic2 G T 11: 114,732,955 G15W probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Gli1 A T 10: 127,330,219 V1055E probably damaging Het
Hand2 G T 8: 57,321,976 A24S probably benign Het
Helb T C 10: 120,106,037 I249V probably benign Het
Hspa4l G A 3: 40,772,642 V492M probably damaging Het
Hspg2 T C 4: 137,539,349 I1916T probably damaging Het
Igfals G A 17: 24,881,605 V557I possibly damaging Het
Itpa T G 2: 130,681,010 S176A probably damaging Het
Kcnu1 T A 8: 25,885,317 L353H probably damaging Het
Klhl1 A G 14: 96,518,179 F47L probably benign Het
Klhl13 T C X: 23,285,176 D21G probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Krt9 C T 11: 100,190,849 V285I probably damaging Het
Mansc1 T C 6: 134,610,183 R344G possibly damaging Het
Mier2 G T 10: 79,541,797 P439T possibly damaging Het
Mppe1 T A 18: 67,225,886 probably null Het
Nedd4l G A 18: 65,167,535 A243T probably benign Het
Notch4 T A 17: 34,578,069 C934* probably null Het
Nsmce3 C T 7: 64,872,168 D251N probably damaging Het
Olfr101 T A 17: 37,299,979 T148S probably benign Het
Olfr1156 T A 2: 87,949,530 R234S probably damaging Het
Olfr1310 T C 2: 112,008,323 T288A possibly damaging Het
Olfr139 A G 11: 74,044,699 C192R probably damaging Het
Olfr517 C T 7: 108,869,128 V9M probably damaging Het
Olfr937 A G 9: 39,060,174 I164T probably benign Het
Pdzd7 T C 19: 45,045,628 T6A probably benign Het
Picalm T A 7: 90,189,219 F493Y probably damaging Het
Prl7d1 A G 13: 27,716,668 M1T probably null Het
Prl8a1 T C 13: 27,575,458 K199E possibly damaging Het
Rims1 C T 1: 22,428,489 R764H probably damaging Het
Rnf17 G T 14: 56,475,413 R779L possibly damaging Het
Rufy2 T C 10: 62,998,137 L294P probably damaging Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Slc22a30 G T 19: 8,336,849 T491K probably benign Het
Slc35b3 T C 13: 38,943,068 N20D possibly damaging Het
Slc5a4a T C 10: 76,181,655 F429L probably benign Het
Sulf1 T C 1: 12,817,412 I270T probably damaging Het
Tmem51 T C 4: 142,031,748 T230A probably damaging Het
Tnc T A 4: 64,008,710 I860F probably damaging Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Ttn T G 2: 76,754,099 T22222P probably damaging Het
Uroc1 A T 6: 90,361,512 K652* probably null Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vmn2r120 A T 17: 57,524,954 F278L probably benign Het
Vmn2r7 A G 3: 64,719,611 F86L possibly damaging Het
Vmn2r87 A T 10: 130,479,987 I70K possibly damaging Het
Vps13a C T 19: 16,744,953 A332T probably benign Het
Zfp568 T A 7: 30,023,396 C589S probably damaging Het
Other mutations in Dsg1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Dsg1c APN 18 20274676 missense probably damaging 1.00
IGL00596:Dsg1c APN 18 20281842 splice site probably benign
IGL01412:Dsg1c APN 18 20247461 missense probably benign
IGL02037:Dsg1c APN 18 20276950 missense probably benign 0.02
IGL02247:Dsg1c APN 18 20264316 missense probably damaging 1.00
IGL02386:Dsg1c APN 18 20276999 missense probably benign
IGL02408:Dsg1c APN 18 20274719 missense probably damaging 1.00
IGL02519:Dsg1c APN 18 20283733 missense probably damaging 1.00
IGL02591:Dsg1c APN 18 20275192 missense probably damaging 1.00
IGL02730:Dsg1c APN 18 20274830 missense probably damaging 1.00
IGL02836:Dsg1c APN 18 20267929 missense probably benign 0.07
IGL03335:Dsg1c APN 18 20283697 missense probably benign 0.01
R0385:Dsg1c UTSW 18 20283654 missense probably damaging 1.00
R0561:Dsg1c UTSW 18 20274775 missense probably benign 0.04
R0570:Dsg1c UTSW 18 20270378 missense probably damaging 1.00
R0573:Dsg1c UTSW 18 20279241 missense probably benign 0.02
R0621:Dsg1c UTSW 18 20279695 missense possibly damaging 0.62
R0632:Dsg1c UTSW 18 20272346 splice site probably benign
R1183:Dsg1c UTSW 18 20283198 missense probably damaging 1.00
R1529:Dsg1c UTSW 18 20282023 missense probably damaging 1.00
R1596:Dsg1c UTSW 18 20282047 missense probably damaging 1.00
R1619:Dsg1c UTSW 18 20264842 missense probably benign 0.36
R1623:Dsg1c UTSW 18 20275177 missense probably damaging 1.00
R1844:Dsg1c UTSW 18 20283039 splice site probably null
R1881:Dsg1c UTSW 18 20272540 splice site probably benign
R2017:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R2072:Dsg1c UTSW 18 20275252 missense probably benign 0.09
R2319:Dsg1c UTSW 18 20275178 missense probably damaging 1.00
R2340:Dsg1c UTSW 18 20267888 missense probably damaging 1.00
R3403:Dsg1c UTSW 18 20270350 missense probably damaging 1.00
R3407:Dsg1c UTSW 18 20282058 critical splice donor site probably null
R3910:Dsg1c UTSW 18 20266196 missense possibly damaging 0.67
R4535:Dsg1c UTSW 18 20275265 missense probably benign 0.01
R4739:Dsg1c UTSW 18 20275189 missense possibly damaging 0.95
R5038:Dsg1c UTSW 18 20264844 missense probably benign 0.00
R5165:Dsg1c UTSW 18 20277023 missense probably damaging 1.00
R5210:Dsg1c UTSW 18 20274701 missense probably damaging 0.97
R5253:Dsg1c UTSW 18 20272379 missense probably damaging 1.00
R5327:Dsg1c UTSW 18 20267937 missense possibly damaging 0.75
R5361:Dsg1c UTSW 18 20283646 missense possibly damaging 0.94
R5475:Dsg1c UTSW 18 20282031 missense probably damaging 0.99
R5512:Dsg1c UTSW 18 20272511 missense probably damaging 1.00
R5681:Dsg1c UTSW 18 20283213 missense probably damaging 1.00
R5710:Dsg1c UTSW 18 20272351 missense probably benign 0.06
R5889:Dsg1c UTSW 18 20283601 missense possibly damaging 0.87
R6513:Dsg1c UTSW 18 20274630 missense probably benign 0.01
R6596:Dsg1c UTSW 18 20270524 intron probably null
R6941:Dsg1c UTSW 18 20267923 missense probably damaging 0.96
R7041:Dsg1c UTSW 18 20266144 missense probably damaging 1.00
R7061:Dsg1c UTSW 18 20277009 missense probably benign
R7240:Dsg1c UTSW 18 20283109 missense probably damaging 1.00
X0026:Dsg1c UTSW 18 20283258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACAGATTCCCTTCAGAGG -3'
(R):5'- TGTTGTGGCCCCAGATGTAC -3'

Sequencing Primer
(F):5'- AGATTCCCTTCAGAGGACCTG -3'
(R):5'- TTGTGGCCCCAGATGTACCATAG -3'
Posted On2015-04-06