Incidental Mutation 'R3875:Glyctk'
ID276797
Institutional Source Beutler Lab
Gene Symbol Glyctk
Ensembl Gene ENSMUSG00000020258
Gene Nameglycerate kinase
Synonyms6230410P16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3875 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location106152857-106158138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106157621 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 82 (Y82F)
Ref Sequence ENSEMBL: ENSMUSP00000125392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036382] [ENSMUST00000112543] [ENSMUST00000159809] [ENSMUST00000162562] [ENSMUST00000217417]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036382
AA Change: Y82F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047761
Gene: ENSMUSG00000020258
AA Change: Y82F

DomainStartEndE-ValueType
Pfam:DUF4147 36 291 1.9e-84 PFAM
low complexity region 363 383 N/A INTRINSIC
Pfam:MOFRL 401 514 3.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083473
Predicted Effect possibly damaging
Transcript: ENSMUST00000112543
AA Change: Y82F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108162
Gene: ENSMUSG00000020258
AA Change: Y82F

DomainStartEndE-ValueType
Pfam:DUF4147 37 290 1.6e-86 PFAM
low complexity region 363 383 N/A INTRINSIC
Pfam:MOFRL 402 514 7.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143956
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150953
Predicted Effect probably damaging
Transcript: ENSMUST00000159809
AA Change: Y82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125369
Gene: ENSMUSG00000020258
AA Change: Y82F

DomainStartEndE-ValueType
Pfam:DUF4147 36 92 8.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160569
Predicted Effect probably damaging
Transcript: ENSMUST00000162562
AA Change: Y82F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125392
Gene: ENSMUSG00000020258
AA Change: Y82F

DomainStartEndE-ValueType
Pfam:DUF4147 36 124 6.4e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217417
Meta Mutation Damage Score 0.106 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the glycerate kinase type-2 family. The encoded enzyme catalyzes the phosphorylation of (R)-glycerate and may be involved in serine degradation and fructose metabolism. Decreased activity of the encoded enzyme may be associated with the disease D-glyceric aciduria. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mcoln1 A G 8: 3,508,355 D203G probably benign Het
Mlph T C 1: 90,928,122 C57R probably damaging Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rad21 A T 15: 51,969,965 F373I probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Tmem221 T C 8: 71,555,755 probably null Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Trim32 A T 4: 65,613,466 I87F possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp106 T C 2: 120,534,613 K438E probably benign Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Glyctk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Glyctk APN 9 106155272 missense probably damaging 1.00
IGL02307:Glyctk APN 9 106155764 missense possibly damaging 0.64
IGL02581:Glyctk APN 9 106157781 missense probably benign
R0106:Glyctk UTSW 9 106155969 missense probably benign 0.00
R1465:Glyctk UTSW 9 106157607 missense probably damaging 1.00
R1465:Glyctk UTSW 9 106157607 missense probably damaging 1.00
R1652:Glyctk UTSW 9 106157157 missense probably damaging 1.00
R1859:Glyctk UTSW 9 106157532 missense probably benign 0.08
R1870:Glyctk UTSW 9 106155348 missense probably damaging 1.00
R1962:Glyctk UTSW 9 106157865 start codon destroyed probably null 0.99
R4167:Glyctk UTSW 9 106157762 missense probably benign 0.01
R4407:Glyctk UTSW 9 106157108 intron probably benign
R5860:Glyctk UTSW 9 106155707 missense possibly damaging 0.54
R6167:Glyctk UTSW 9 106156492 missense possibly damaging 0.75
R6240:Glyctk UTSW 9 106156262 intron probably null
R7253:Glyctk UTSW 9 106155462 missense probably damaging 1.00
X0004:Glyctk UTSW 9 106155719 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTTCCAAAGGACAGTAGAGGG -3'
(R):5'- CTCTAGGCAGCTATGGACAC -3'

Sequencing Primer
(F):5'- ACAGTAGAGGGCGTCCC -3'
(R):5'- TATGGACACGAGGCTGTGC -3'
Posted On2015-04-06