Incidental Mutation 'R3875:Rad21'
ID276817
Institutional Source Beutler Lab
Gene Symbol Rad21
Ensembl Gene ENSMUSG00000022314
Gene NameRAD21 cohesin complex component
SynonymsSCC1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3875 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location51962240-51991747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 51969965 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 373 (F373I)
Ref Sequence ENSEMBL: ENSMUSP00000022927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022927] [ENSMUST00000226529]
Predicted Effect probably damaging
Transcript: ENSMUST00000022927
AA Change: F373I

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022927
Gene: ENSMUSG00000022314
AA Change: F373I

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 107 6.6e-43 PFAM
low complexity region 267 283 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
low complexity region 521 547 N/A INTRINSIC
Pfam:Rad21_Rec8 578 632 2.4e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226529
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad21, a gene involved in the repair of DNA double-strand breaks, as well as in chromatid cohesion during mitosis. This protein is a nuclear phospho-protein, which becomes hyperphosphorylated in cell cycle M phase. The highly regulated association of this protein with mitotic chromatin specifically at the centromere region suggests its role in sister chromatid cohesion in mitotic cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality, reduced male fertility, and produce oocytes that fail to maintain sister chromatids in the first mitosis following fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6820408C15Rik T C 2: 152,434,080 S72P probably benign Het
Abca5 T A 11: 110,310,233 Y447F probably damaging Het
Adgrg2 A G X: 160,478,996 S337G probably benign Het
Akap12 G A 10: 4,357,590 V1467I probably benign Het
Baz2a T A 10: 128,124,110 M1419K probably damaging Het
Cacna1g G A 11: 94,437,923 T1033I probably damaging Het
Car12 C A 9: 66,717,552 probably benign Het
Cpne1 G A 2: 156,076,282 H352Y probably damaging Het
D630039A03Rik T A 4: 57,910,606 T69S probably benign Het
Dhodh T C 8: 109,594,960 D310G probably null Het
Dnah2 A G 11: 69,429,348 I3965T probably damaging Het
Drd5 T G 5: 38,319,814 V50G possibly damaging Het
Dst C A 1: 34,171,247 H934Q probably damaging Het
Far2 G A 6: 148,150,591 E123K probably benign Het
Fbxo43 A T 15: 36,162,103 F319L probably benign Het
Flii T C 11: 60,720,492 S418G probably benign Het
Glyctk T A 9: 106,157,621 Y82F probably damaging Het
Gm11353 G T 13: 26,492,668 noncoding transcript Het
Gm6505 T A 3: 28,765,137 noncoding transcript Het
Gm8332 T C 12: 88,249,706 D132G unknown Het
Gpr151 A G 18: 42,578,596 V339A probably benign Het
H2-T22 T C 17: 36,040,303 I296V probably benign Het
Igfn1 T C 1: 135,954,614 N2831S probably damaging Het
Igkv13-85 A G 6: 68,930,500 V39A probably damaging Het
Irx5 A G 8: 92,360,165 T242A probably benign Het
Krt26 T C 11: 99,334,744 K304E probably damaging Het
Mcoln1 A G 8: 3,508,355 D203G probably benign Het
Mlph T C 1: 90,928,122 C57R probably damaging Het
Myh13 C A 11: 67,358,194 H1275Q probably benign Het
Nbeal1 T A 1: 60,194,599 probably benign Het
Orc5 T A 5: 22,537,566 M115L probably benign Het
Pcdha6 T A 18: 36,968,066 I104N probably damaging Het
Plcb4 T C 2: 136,002,632 S157P probably damaging Het
Polq A G 16: 37,074,027 D1787G probably damaging Het
Prkar2b T G 12: 31,965,123 I142L probably benign Het
Ptprq A G 10: 107,685,104 S736P possibly damaging Het
Qrich2 A T 11: 116,445,651 V2046D probably damaging Het
Rcvrn A G 11: 67,700,054 I155V probably benign Het
Rsrc2 C T 5: 123,736,628 probably benign Het
Sgsh A G 11: 119,350,947 L111P probably damaging Het
Ssc5d A T 7: 4,927,262 D114V probably damaging Het
St6gal2 C A 17: 55,482,697 P244Q probably benign Het
Tarbp1 A G 8: 126,438,799 probably benign Het
Tmem221 T C 8: 71,555,755 probably null Het
Trh A T 6: 92,243,698 V61E possibly damaging Het
Trim32 A T 4: 65,613,466 I87F possibly damaging Het
Tti2 A G 8: 31,151,147 K100E probably benign Het
Usp34 C T 11: 23,489,033 P3532S possibly damaging Het
Vps13d A G 4: 145,190,544 Y17H probably damaging Het
Zfp106 T C 2: 120,534,613 K438E probably benign Het
Zfp60 T C 7: 27,749,581 I558T probably damaging Het
Zzef1 A C 11: 72,889,040 I1880L probably benign Het
Other mutations in Rad21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Rad21 APN 15 51976125 missense possibly damaging 0.76
IGL01328:Rad21 APN 15 51973124 missense probably damaging 1.00
PIT4449001:Rad21 UTSW 15 51973243 missense probably benign 0.25
R0119:Rad21 UTSW 15 51965030 missense probably benign 0.01
R0299:Rad21 UTSW 15 51965030 missense probably benign 0.01
R0385:Rad21 UTSW 15 51973863 missense possibly damaging 0.70
R0440:Rad21 UTSW 15 51968358 missense probably benign 0.24
R1216:Rad21 UTSW 15 51970136 missense possibly damaging 0.70
R1631:Rad21 UTSW 15 51970040 missense probably damaging 1.00
R1763:Rad21 UTSW 15 51978170 missense probably damaging 1.00
R1769:Rad21 UTSW 15 51972307 missense probably benign
R2377:Rad21 UTSW 15 51968438 missense probably damaging 0.99
R2761:Rad21 UTSW 15 51982643 missense probably damaging 1.00
R3116:Rad21 UTSW 15 51965001 missense probably null 1.00
R3853:Rad21 UTSW 15 51972316 missense probably benign
R4618:Rad21 UTSW 15 51970024 missense probably damaging 1.00
R4856:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R4886:Rad21 UTSW 15 51968500 missense probably damaging 1.00
R5022:Rad21 UTSW 15 51966706 missense probably benign 0.02
R5057:Rad21 UTSW 15 51966706 missense probably benign 0.02
R7288:Rad21 UTSW 15 51982580 missense possibly damaging 0.94
Z1088:Rad21 UTSW 15 51982626 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCAGTACGTGAGCCAAGCTG -3'
(R):5'- GCTGGCTCTCAAGAAAGTGACC -3'

Sequencing Primer
(F):5'- GCCCTAAGCATACCGTGATTTAAGG -3'
(R):5'- AAGACCATTAGAGCCCAG -3'
Posted On2015-04-06