Incidental Mutation 'R3876:Pald1'
ID276850
Institutional Source Beutler Lab
Gene Symbol Pald1
Ensembl Gene ENSMUSG00000020092
Gene Namephosphatase domain containing, paladin 1
Synonymspaladin, X99384
MMRRC Submission 041606-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R3876 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location61319656-61383530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61347487 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 323 (N323Y)
Ref Sequence ENSEMBL: ENSMUSP00000020289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020289]
Predicted Effect probably damaging
Transcript: ENSMUST00000020289
AA Change: N323Y

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020289
Gene: ENSMUSG00000020092
AA Change: N323Y

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
PTPlike_phytase 164 333 4.33e-53 SMART
low complexity region 428 441 N/A INTRINSIC
PTPlike_phytase 548 682 5.37e-49 SMART
low complexity region 757 768 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219132
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik G A 14: 54,591,400 R215* probably null Het
Brinp2 C A 1: 158,246,846 L568F probably damaging Het
Brip1 T C 11: 86,152,790 Y316C probably damaging Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cfap69 G T 5: 5,584,645 probably benign Het
Chrnb4 T C 9: 55,043,898 E27G probably damaging Het
Clec14a A G 12: 58,268,644 V64A possibly damaging Het
Crygs A G 16: 22,806,512 Y60H probably damaging Het
Dpp10 T A 1: 123,353,487 Q611L probably damaging Het
Entpd1 T C 19: 40,736,820 L450P probably damaging Het
Eogt G A 6: 97,120,190 S317L probably damaging Het
Exosc10 T A 4: 148,572,919 S584T probably benign Het
Fam184a C T 10: 53,699,061 V151I probably damaging Het
Fbxo43 A G 15: 36,152,112 V517A probably damaging Het
Flii T C 11: 60,719,872 T533A possibly damaging Het
Frmpd1 T G 4: 45,284,093 H971Q probably benign Het
Gata3 A T 2: 9,863,143 N333K probably damaging Het
Hectd1 A G 12: 51,768,730 S1525P probably damaging Het
Ibtk A G 9: 85,718,426 I816T probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt34 T C 11: 100,040,965 T143A probably benign Het
Lipn G T 19: 34,069,428 M43I probably benign Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Mios G A 6: 8,233,189 R779Q probably damaging Het
Mme A T 3: 63,362,059 probably benign Het
Ncstn A G 1: 172,070,073 S418P probably benign Het
Olfr1209 T C 2: 88,909,608 T262A possibly damaging Het
Olfr1285 T C 2: 111,408,622 V69A possibly damaging Het
Olfr5 G A 7: 6,481,132 A8V probably benign Het
Olfr800 C T 10: 129,660,274 P156L probably benign Het
Olfr934 T A 9: 38,982,870 Y58F probably damaging Het
Oprk1 T A 1: 5,602,661 C340* probably null Het
Pcdhac1 C A 18: 37,091,892 A586E probably damaging Het
Pcnx2 C T 8: 125,888,158 A185T probably benign Het
Pik3r1 G A 13: 101,684,957 H430Y probably benign Het
Polr3b G A 10: 84,720,518 probably null Het
Prl8a6 A T 13: 27,433,032 L225* probably null Het
Psme4 T C 11: 30,856,068 S89P probably damaging Het
Pygl G A 12: 70,201,339 T250I probably damaging Het
Rgs13 T A 1: 144,140,790 K72* probably null Het
Ryr2 T A 13: 11,588,159 I4514F probably damaging Het
Sept3 A T 15: 82,285,801 D32V probably damaging Het
Sfrp2 C T 3: 83,767,028 P163S possibly damaging Het
Spata31 A G 13: 64,920,931 T298A probably benign Het
Stxbp2 T C 8: 3,633,369 probably null Het
Syne1 A T 10: 5,052,345 M282K possibly damaging Het
Timd2 T C 11: 46,671,020 probably null Het
Tlr11 G A 14: 50,363,154 V866I probably benign Het
Trappc10 T C 10: 78,220,186 probably null Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Pald1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02183:Pald1 APN 10 61347141 splice site probably benign
IGL03068:Pald1 APN 10 61321184 missense possibly damaging 0.94
IGL03106:Pald1 APN 10 61347105 missense probably benign 0.41
R0331:Pald1 UTSW 10 61340929 critical splice donor site probably null
R0497:Pald1 UTSW 10 61341315 missense probably damaging 0.99
R1181:Pald1 UTSW 10 61347587 splice site probably benign
R1437:Pald1 UTSW 10 61341285 missense possibly damaging 0.63
R1466:Pald1 UTSW 10 61348525 splice site probably benign
R1827:Pald1 UTSW 10 61355922 small deletion probably benign
R2129:Pald1 UTSW 10 61348306 critical splice donor site probably null
R2184:Pald1 UTSW 10 61347136 missense possibly damaging 0.46
R2260:Pald1 UTSW 10 61352971 missense probably damaging 1.00
R3051:Pald1 UTSW 10 61346763 nonsense probably null
R3690:Pald1 UTSW 10 61355808 splice site probably null
R3713:Pald1 UTSW 10 61342365 missense possibly damaging 0.67
R4261:Pald1 UTSW 10 61343692 missense probably damaging 1.00
R4600:Pald1 UTSW 10 61348616 missense probably benign 0.00
R4603:Pald1 UTSW 10 61348616 missense probably benign 0.00
R5069:Pald1 UTSW 10 61341246 missense possibly damaging 0.50
R5354:Pald1 UTSW 10 61348661 missense probably damaging 1.00
R5590:Pald1 UTSW 10 61343710 missense probably damaging 1.00
R5705:Pald1 UTSW 10 61323297 missense possibly damaging 0.90
R5780:Pald1 UTSW 10 61339218 missense probably damaging 1.00
R6239:Pald1 UTSW 10 61321131 missense possibly damaging 0.59
R6380:Pald1 UTSW 10 61350935 missense possibly damaging 0.86
R6812:Pald1 UTSW 10 61342922 missense possibly damaging 0.53
R6891:Pald1 UTSW 10 61348532 critical splice donor site probably null
R6949:Pald1 UTSW 10 61321217 missense probably benign 0.23
R7038:Pald1 UTSW 10 61339299 missense probably benign
R7051:Pald1 UTSW 10 61323346 missense probably benign 0.26
R7188:Pald1 UTSW 10 61347066 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAAGATGCTCTGTCCTCTGG -3'
(R):5'- AATGGATGGGTCAGATCTGGC -3'

Sequencing Primer
(F):5'- CAAAGATGCTCTGTCCTCTGGATATG -3'
(R):5'- CAGCTTGCTGCAGATGTCG -3'
Posted On2015-04-06