Incidental Mutation 'R3877:Tram1'
ID276874
Institutional Source Beutler Lab
Gene Symbol Tram1
Ensembl Gene ENSMUSG00000025935
Gene Nametranslocating chain-associating membrane protein 1
SynonymsTRAMP, 1810049E02Rik
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location13564698-13589910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13569603 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 307 (T307A)
Ref Sequence ENSEMBL: ENSMUSP00000027068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027068]
Predicted Effect probably benign
Transcript: ENSMUST00000027068
AA Change: T307A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000027068
Gene: ENSMUSG00000025935
AA Change: T307A

DomainStartEndE-ValueType
Pfam:TRAM1 47 115 6.1e-24 PFAM
TLC 117 326 2.36e-54 SMART
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a multi-pass transmembrane protein of the endoplasmic reticulum (ER). It is involved in the process of cotranslational translocation of secretory proteins into the ER. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Tram1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Tram1 APN 1 13579449 critical splice donor site probably null
IGL03071:Tram1 APN 1 13579774 nonsense probably null
IGL03123:Tram1 APN 1 13589605 missense probably benign 0.01
R0764:Tram1 UTSW 1 13579709 missense probably damaging 1.00
R1229:Tram1 UTSW 1 13569552 missense probably damaging 0.98
R1775:Tram1 UTSW 1 13576456 unclassified probably benign
R4077:Tram1 UTSW 1 13566375 missense probably benign
R4747:Tram1 UTSW 1 13589646 missense probably damaging 1.00
R5197:Tram1 UTSW 1 13571902 missense probably benign 0.19
R5213:Tram1 UTSW 1 13579742 missense probably damaging 1.00
R5224:Tram1 UTSW 1 13578125 missense probably benign 0.10
R7362:Tram1 UTSW 1 13589608 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCCCCGTAGCTAAGATTCTG -3'
(R):5'- GGTTTCTGTCCATGTGAGACAG -3'

Sequencing Primer
(F):5'- CGTAGCTAAGATTCTGCATGC -3'
(R):5'- CTGTCCATGTGAGACAGTACTAAAGC -3'
Posted On2015-04-06