Incidental Mutation 'R3877:Arhgap21'
ID276879
Institutional Source Beutler Lab
Gene Symbol Arhgap21
Ensembl Gene ENSMUSG00000036591
Gene NameRho GTPase activating protein 21
SynonymsARHGAP10, 5530401C11Rik
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location20847919-20968881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20859906 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1197 (M1197K)
Ref Sequence ENSEMBL: ENSMUSP00000133851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000173784] [ENSMUST00000174584]
Predicted Effect probably damaging
Transcript: ENSMUST00000114594
AA Change: M1201K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: M1201K

DomainStartEndE-ValueType
PDZ 58 159 1.03e-16 SMART
low complexity region 351 362 N/A INTRINSIC
low complexity region 445 459 N/A INTRINSIC
low complexity region 625 635 N/A INTRINSIC
low complexity region 911 925 N/A INTRINSIC
PH 930 1040 2.09e-16 SMART
RhoGAP 1157 1334 3.26e-62 SMART
low complexity region 1381 1399 N/A INTRINSIC
low complexity region 1448 1466 N/A INTRINSIC
low complexity region 1533 1565 N/A INTRINSIC
low complexity region 1573 1593 N/A INTRINSIC
low complexity region 1891 1900 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136241
Predicted Effect possibly damaging
Transcript: ENSMUST00000141298
AA Change: M1207K

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: M1207K

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154230
AA Change: M1207K

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: M1207K

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 357 368 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 631 641 N/A INTRINSIC
low complexity region 917 931 N/A INTRINSIC
PH 936 1046 2.09e-16 SMART
RhoGAP 1163 1340 3.26e-62 SMART
low complexity region 1387 1405 N/A INTRINSIC
low complexity region 1454 1472 N/A INTRINSIC
low complexity region 1539 1571 N/A INTRINSIC
low complexity region 1579 1599 N/A INTRINSIC
low complexity region 1897 1906 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154657
Predicted Effect probably damaging
Transcript: ENSMUST00000173194
AA Change: M1197K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: M1197K

DomainStartEndE-ValueType
PDZ 64 165 1.03e-16 SMART
low complexity region 347 358 N/A INTRINSIC
low complexity region 441 455 N/A INTRINSIC
low complexity region 621 631 N/A INTRINSIC
low complexity region 907 921 N/A INTRINSIC
PH 926 1036 2.09e-16 SMART
RhoGAP 1153 1330 3.26e-62 SMART
low complexity region 1377 1395 N/A INTRINSIC
low complexity region 1444 1462 N/A INTRINSIC
low complexity region 1529 1561 N/A INTRINSIC
low complexity region 1569 1589 N/A INTRINSIC
low complexity region 1887 1896 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173784
AA Change: M312K

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133539
Gene: ENSMUSG00000036591
AA Change: M312K

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
PH 40 150 2.09e-16 SMART
RhoGAP 268 395 1.55e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174584
AA Change: M1036K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: M1036K

DomainStartEndE-ValueType
low complexity region 186 197 N/A INTRINSIC
low complexity region 280 294 N/A INTRINSIC
low complexity region 460 470 N/A INTRINSIC
low complexity region 746 760 N/A INTRINSIC
PH 765 875 2.09e-16 SMART
RhoGAP 992 1169 3.26e-62 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174825
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Arhgap21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Arhgap21 APN 2 20855700 missense probably damaging 1.00
IGL01472:Arhgap21 APN 2 20849581 missense probably damaging 1.00
IGL01634:Arhgap21 APN 2 20914644 missense probably benign 0.00
IGL01766:Arhgap21 APN 2 20849637 missense possibly damaging 0.68
IGL02097:Arhgap21 APN 2 20880002 missense probably benign 0.39
IGL02197:Arhgap21 APN 2 20880306 missense probably benign
IGL02264:Arhgap21 APN 2 20860039 splice site probably null
IGL02346:Arhgap21 APN 2 20879951 splice site probably benign
IGL02418:Arhgap21 APN 2 20880900 missense probably damaging 1.00
IGL02605:Arhgap21 APN 2 20855588 missense probably damaging 1.00
IGL02701:Arhgap21 APN 2 20892091 missense probably damaging 1.00
IGL03019:Arhgap21 APN 2 20861063 missense probably damaging 1.00
IGL03085:Arhgap21 APN 2 20914721 missense probably benign
IGL03265:Arhgap21 APN 2 20849628 missense probably benign 0.03
IGL03379:Arhgap21 APN 2 20880689 missense probably benign 0.41
R0304:Arhgap21 UTSW 2 20859801 splice site probably benign
R0363:Arhgap21 UTSW 2 20881133 missense probably damaging 1.00
R0498:Arhgap21 UTSW 2 20863117 missense probably damaging 1.00
R0539:Arhgap21 UTSW 2 20914799 nonsense probably null
R0633:Arhgap21 UTSW 2 20855387 nonsense probably null
R0905:Arhgap21 UTSW 2 20849934 missense possibly damaging 0.88
R1550:Arhgap21 UTSW 2 20881765 nonsense probably null
R1570:Arhgap21 UTSW 2 20880840 missense probably benign
R1686:Arhgap21 UTSW 2 20881848 missense probably damaging 1.00
R1746:Arhgap21 UTSW 2 20861099 missense probably damaging 0.99
R1864:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R1865:Arhgap21 UTSW 2 20861204 missense probably damaging 1.00
R2209:Arhgap21 UTSW 2 20849520 missense probably damaging 1.00
R2211:Arhgap21 UTSW 2 20881640 missense possibly damaging 0.56
R2276:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2277:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2279:Arhgap21 UTSW 2 20863226 missense possibly damaging 0.94
R2336:Arhgap21 UTSW 2 20880051 missense probably damaging 1.00
R2516:Arhgap21 UTSW 2 20854998 missense probably damaging 1.00
R3722:Arhgap21 UTSW 2 20850291 missense probably damaging 1.00
R4017:Arhgap21 UTSW 2 20892104 missense probably benign 0.10
R4232:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4233:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4234:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4235:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4236:Arhgap21 UTSW 2 20887137 missense probably damaging 1.00
R4434:Arhgap21 UTSW 2 20967335 missense probably benign
R4686:Arhgap21 UTSW 2 20863222 missense probably damaging 1.00
R4817:Arhgap21 UTSW 2 20850156 missense probably benign
R4834:Arhgap21 UTSW 2 20865319 missense probably damaging 1.00
R4845:Arhgap21 UTSW 2 20881187 missense probably damaging 0.99
R4889:Arhgap21 UTSW 2 20880468 missense probably benign 0.10
R4904:Arhgap21 UTSW 2 20850061 missense probably benign 0.00
R4911:Arhgap21 UTSW 2 20858989 missense probably damaging 1.00
R4994:Arhgap21 UTSW 2 20849890 missense probably benign 0.00
R5067:Arhgap21 UTSW 2 20880037 missense probably damaging 1.00
R5086:Arhgap21 UTSW 2 20848834 missense probably benign 0.00
R5281:Arhgap21 UTSW 2 20849316 missense probably damaging 1.00
R5364:Arhgap21 UTSW 2 20849722 missense probably damaging 1.00
R5420:Arhgap21 UTSW 2 20881086 missense probably damaging 0.99
R5476:Arhgap21 UTSW 2 20880686 missense probably benign 0.06
R5831:Arhgap21 UTSW 2 20863213 missense probably damaging 1.00
R5949:Arhgap21 UTSW 2 20849041 missense probably damaging 0.97
R5994:Arhgap21 UTSW 2 20881376 missense possibly damaging 0.78
R6014:Arhgap21 UTSW 2 20881805 missense probably damaging 1.00
R6739:Arhgap21 UTSW 2 20880732 missense possibly damaging 0.94
R6817:Arhgap21 UTSW 2 20880296 missense probably benign 0.23
R6821:Arhgap21 UTSW 2 20848848 missense probably benign
R6844:Arhgap21 UTSW 2 20881305 missense probably benign 0.00
R6870:Arhgap21 UTSW 2 20880510 missense probably damaging 1.00
R6891:Arhgap21 UTSW 2 20850331 missense probably damaging 0.97
R7011:Arhgap21 UTSW 2 20848878 missense possibly damaging 0.65
R7144:Arhgap21 UTSW 2 20865387 missense probably benign
R7237:Arhgap21 UTSW 2 20849972 nonsense probably null
R7261:Arhgap21 UTSW 2 20880366 missense probably benign
R7558:Arhgap21 UTSW 2 20855610 missense not run
R7566:Arhgap21 UTSW 2 20912291 missense not run
Predicted Primers PCR Primer
(F):5'- CTCACCATTCGTAAAGAGAGGCTC -3'
(R):5'- TCGGAAATGGTCAGTAGGGATTC -3'

Sequencing Primer
(F):5'- CTCAGGGAGCTTTCTGAAGAAG -3'
(R):5'- GGGATTCATTTTCAAACTTCGGTAC -3'
Posted On2015-04-06