Incidental Mutation 'R3877:Tnfaip6'
ID276882
Institutional Source Beutler Lab
Gene Symbol Tnfaip6
Ensembl Gene ENSMUSG00000053475
Gene Nametumor necrosis factor alpha induced protein 6
SynonymsTnfip6, TSG-6, Tsg6
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52038009-52056686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52052327 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 216 (E216G)
Ref Sequence ENSEMBL: ENSMUSP00000069231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065927]
Predicted Effect probably benign
Transcript: ENSMUST00000065927
AA Change: E216G

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000069231
Gene: ENSMUSG00000053475
AA Change: E216G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LINK 34 129 1.06e-53 SMART
CUB 135 247 2.66e-47 SMART
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]
PHENOTYPE: Females lacking functional copies of this gene are infertile due to failed cumulus-oocyte complex expansion. Mice show attenuated acute allergic pulmonary inflammation and are resistant to induction of airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Tnfaip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tnfaip6 APN 2 52055847 missense probably damaging 1.00
IGL01565:Tnfaip6 APN 2 52055834 missense probably damaging 1.00
R0118:Tnfaip6 UTSW 2 52043815 nonsense probably null
R0279:Tnfaip6 UTSW 2 52055916 missense possibly damaging 0.95
R2138:Tnfaip6 UTSW 2 52052332 missense possibly damaging 0.51
R2152:Tnfaip6 UTSW 2 52043730 missense probably damaging 1.00
R2240:Tnfaip6 UTSW 2 52050914 missense probably benign 0.16
R4235:Tnfaip6 UTSW 2 52050864 missense probably damaging 0.99
R4857:Tnfaip6 UTSW 2 52051074 splice site probably null
R5658:Tnfaip6 UTSW 2 52051035 missense possibly damaging 0.66
R6476:Tnfaip6 UTSW 2 52052316 missense probably benign
R6657:Tnfaip6 UTSW 2 52043783 missense probably damaging 1.00
R7424:Tnfaip6 UTSW 2 52038216 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGTTCAAGTCAGTCTCTCCC -3'
(R):5'- ACAGAGTTGGCCAAAGTCTTAAC -3'

Sequencing Primer
(F):5'- GAGTTTGAGGCCAATCTGATCTACAG -3'
(R):5'- GGCCAAAGTCTTAACAATAAAAACTG -3'
Posted On2015-04-06