Incidental Mutation 'R3877:Cldn19'
ID 276895
Institutional Source Beutler Lab
Gene Symbol Cldn19
Ensembl Gene ENSMUSG00000066058
Gene Name claudin 19
Synonyms
MMRRC Submission 040904-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3877 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 119112638-119119635 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 119114094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 79 (S79P)
Ref Sequence ENSEMBL: ENSMUSP00000092418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084309] [ENSMUST00000094823]
AlphaFold Q9ET38
Predicted Effect possibly damaging
Transcript: ENSMUST00000084309
AA Change: S79P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081334
Gene: ENSMUSG00000066058
AA Change: S79P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 5.8e-45 PFAM
Pfam:Claudin_2 15 184 1.1e-10 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094823
AA Change: S79P

PolyPhen 2 Score 0.699 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092418
Gene: ENSMUSG00000066058
AA Change: S79P

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 6.1e-43 PFAM
Pfam:Claudin_2 15 184 2.6e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150252
Meta Mutation Damage Score 0.2453 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. siRNA knockdown of this gene in mice develops the FHHNC (familial hypomagnesemia with hypercalciuria and nephrocalcinosis) symptoms of chronic renal wasting of magnesium and calcium together with defective renal salt handling. The protein encoded by this gene interacts with another family member, Claudin 16, and their interaction is required for their assembly into tight junctions and for renal reabsorption of magnesium. This protein is a constituent of tight junctions in the Schwann cells of peripheral myelinated nerves and the gene deficiency affects the nerve conduction of peripheral myelinated fibers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a peripheral neuropathy associated with significant behavioral abnormalities, a complete lack of tight junctions from myelinated Schwann cells, and abnormal nerve conduction parameters of peripheral myelinated fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 G A 8: 41,249,671 (GRCm39) V594I possibly damaging Het
Adgb A T 10: 10,318,227 (GRCm39) probably null Het
Adgrb3 A C 1: 25,150,906 (GRCm39) L1109R probably damaging Het
Angptl4 G A 17: 33,996,008 (GRCm39) P323S possibly damaging Het
Arhgap21 A T 2: 20,864,717 (GRCm39) M1197K probably damaging Het
Arhgef40 A G 14: 52,239,742 (GRCm39) T1319A probably damaging Het
C4bp A G 1: 130,575,764 (GRCm39) probably null Het
Cd200r1 T C 16: 44,610,374 (GRCm39) S161P possibly damaging Het
Ckap5 A G 2: 91,445,495 (GRCm39) K1711E possibly damaging Het
Cplane1 T C 15: 8,251,427 (GRCm39) S1900P probably benign Het
Dnah17 T G 11: 117,915,533 (GRCm39) N4334T probably damaging Het
Dpm2 G A 2: 32,462,412 (GRCm39) probably null Het
Eef1a2 A T 2: 180,794,626 (GRCm39) V191E probably damaging Het
Gmds G A 13: 32,411,248 (GRCm39) T62I probably damaging Het
Hyal5 A T 6: 24,876,630 (GRCm39) I168F probably damaging Het
Idh3a T C 9: 54,499,679 (GRCm39) V31A probably benign Het
Inf2 C A 12: 112,577,264 (GRCm39) A1036E unknown Het
Kcnd3 C T 3: 105,566,082 (GRCm39) A421V probably damaging Het
Kidins220 T A 12: 25,051,564 (GRCm39) probably benign Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Lrp1b A G 2: 41,335,206 (GRCm39) C779R probably damaging Het
Lrp2 A G 2: 69,289,816 (GRCm39) probably null Het
Lrp2 G A 2: 69,379,391 (GRCm39) T107M probably damaging Het
Lrpap1 T C 5: 35,255,547 (GRCm39) E184G probably benign Het
Mapre1 C T 2: 153,588,201 (GRCm39) T8M possibly damaging Het
Mms19 G A 19: 41,954,695 (GRCm39) Q75* probably null Het
Mtcl1 T C 17: 66,649,949 (GRCm39) I1390V probably damaging Het
Muc5b A G 7: 141,411,289 (GRCm39) S1412G unknown Het
Myh4 A T 11: 67,148,009 (GRCm39) Q1686L probably benign Het
Or1e25 A T 11: 73,493,979 (GRCm39) D191V probably damaging Het
Or9s13 A T 1: 92,547,805 (GRCm39) D59V probably damaging Het
Rcvrn A T 11: 67,590,802 (GRCm39) I129F probably damaging Het
Reg3b T A 6: 78,348,216 (GRCm39) M10K possibly damaging Het
Rimbp2 T A 5: 128,850,529 (GRCm39) E918V probably damaging Het
Rpl5 A G 5: 108,051,667 (GRCm39) T154A probably benign Het
Sall4 A C 2: 168,598,162 (GRCm39) L195R probably damaging Het
Sh3gl2 T C 4: 85,297,618 (GRCm39) S199P possibly damaging Het
Shank1 G T 7: 43,994,416 (GRCm39) R859L unknown Het
Thsd7b A G 1: 130,117,919 (GRCm39) E1445G possibly damaging Het
Tnfaip6 A G 2: 51,942,339 (GRCm39) E216G probably benign Het
Tram1 T C 1: 13,639,827 (GRCm39) T307A probably benign Het
Trpv5 A G 6: 41,637,277 (GRCm39) V354A probably benign Het
Tyro3 A G 2: 119,643,774 (GRCm39) E745G probably damaging Het
Vmn1r68 A T 7: 10,261,408 (GRCm39) I230N probably damaging Het
Vmn2r28 A T 7: 5,491,357 (GRCm39) W297R probably damaging Het
Vrk3 A T 7: 44,412,460 (GRCm39) probably null Het
Zfhx4 T C 3: 5,465,845 (GRCm39) V2001A probably benign Het
Zfp512b AG AGG 2: 181,230,556 (GRCm39) probably null Het
Other mutations in Cldn19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02560:Cldn19 APN 4 119,112,921 (GRCm39) nonsense probably null
R1459:Cldn19 UTSW 4 119,112,810 (GRCm39) missense probably damaging 1.00
R1524:Cldn19 UTSW 4 119,114,248 (GRCm39) critical splice donor site probably null
R1828:Cldn19 UTSW 4 119,112,990 (GRCm39) missense probably benign 0.00
R3008:Cldn19 UTSW 4 119,112,987 (GRCm39) missense probably damaging 1.00
R3709:Cldn19 UTSW 4 119,114,094 (GRCm39) missense possibly damaging 0.70
R4840:Cldn19 UTSW 4 119,112,951 (GRCm39) missense probably damaging 1.00
R5238:Cldn19 UTSW 4 119,112,930 (GRCm39) missense probably damaging 1.00
R5629:Cldn19 UTSW 4 119,114,116 (GRCm39) missense probably damaging 0.98
R7407:Cldn19 UTSW 4 119,112,882 (GRCm39) missense probably damaging 0.98
R9591:Cldn19 UTSW 4 119,114,357 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGACAATGACCTCACTCTGCC -3'
(R):5'- CTAGCCACATAGTCAAGAGGGG -3'

Sequencing Primer
(F):5'- TCTTCTCACAAGCAGGCAAGTG -3'
(R):5'- GAGAGGAAGCTGGGCACTCAC -3'
Posted On 2015-04-06