Incidental Mutation 'R3877:Lrpap1'
ID276896
Institutional Source Beutler Lab
Gene Symbol Lrpap1
Ensembl Gene ENSMUSG00000029103
Gene Namelow density lipoprotein receptor-related protein associated protein 1
SynonymsRAP
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location35091501-35105766 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35098203 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 184 (E184G)
Ref Sequence ENSEMBL: ENSMUSP00000030986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030986]
Predicted Effect probably benign
Transcript: ENSMUST00000030986
AA Change: E184G

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030986
Gene: ENSMUSG00000029103
AA Change: E184G

DomainStartEndE-ValueType
Pfam:Alpha-2-MRAP_N 20 137 7.7e-45 PFAM
Pfam:Alpha-2-MRAP_C 148 360 3.4e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147028
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152028
Predicted Effect probably benign
Transcript: ENSMUST00000153664
SMART Domains Protein: ENSMUSP00000120233
Gene: ENSMUSG00000029103

DomainStartEndE-ValueType
Pfam:Alpha-2-MRAP_C 2 153 4.7e-48 PFAM
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that interacts with the low density lipoprotein (LDL) receptor-related protein and facilitates its proper folding and localization by preventing the binding of ligands. Mutations in this gene have been identified in individuals with myopia 23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, subtle abnormalities are seen in behavior, brain function and thyroid function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Lrpap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02219:Lrpap1 APN 5 35096067 splice site probably benign
IGL03102:Lrpap1 APN 5 35093350 missense probably damaging 0.98
R0029:Lrpap1 UTSW 5 35097677 missense possibly damaging 0.86
R0089:Lrpap1 UTSW 5 35094888 missense possibly damaging 0.93
R1944:Lrpap1 UTSW 5 35097630 missense probably benign 0.00
R1955:Lrpap1 UTSW 5 35102412 missense probably damaging 1.00
R4004:Lrpap1 UTSW 5 35105544 nonsense probably null
R4077:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4078:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4079:Lrpap1 UTSW 5 35096037 missense possibly damaging 0.74
R4782:Lrpap1 UTSW 5 35099278 missense probably damaging 0.99
R4828:Lrpap1 UTSW 5 35102421 missense possibly damaging 0.95
R6672:Lrpap1 UTSW 5 35099233 missense probably benign 0.02
R6925:Lrpap1 UTSW 5 35102536 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATCTGTAGAGCTGTACTGACTG -3'
(R):5'- CCCATCAGGAGCTTCCAAATTG -3'

Sequencing Primer
(F):5'- GCTGTACTGACTGATATAAAAACCG -3'
(R):5'- AGGGTCACAAGGCTTGCTG -3'
Posted On2015-04-06