Incidental Mutation 'R3877:Trpv5'
ID276900
Institutional Source Beutler Lab
Gene Symbol Trpv5
Ensembl Gene ENSMUSG00000036899
Gene Nametransient receptor potential cation channel, subfamily V, member 5
SynonymsECaC1, CaT2
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41652173-41680769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41660343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 354 (V354A)
Ref Sequence ENSEMBL: ENSMUSP00000141421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031901] [ENSMUST00000193503]
Predicted Effect probably benign
Transcript: ENSMUST00000031901
AA Change: V403A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031901
Gene: ENSMUSG00000036899
AA Change: V403A

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 2.3e0 SMART
ANK 110 139 4.56e-4 SMART
ANK 156 185 1.85e-4 SMART
Blast:ANK 189 217 3e-10 BLAST
ANK 232 261 3.07e2 SMART
Pfam:Ion_trans 321 583 1.8e-19 PFAM
low complexity region 676 691 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193503
AA Change: V354A

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141421
Gene: ENSMUSG00000036899
AA Change: V354A

DomainStartEndE-ValueType
Blast:ANK 38 68 1e-7 BLAST
ANK 72 102 1.5e-2 SMART
ANK 110 139 2.8e-6 SMART
ANK 156 185 1.2e-6 SMART
Blast:ANK 189 217 4e-10 BLAST
transmembrane domain 274 296 N/A INTRINSIC
Pfam:Ion_trans 335 522 2.7e-12 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
Meta Mutation Damage Score 0.162 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the transient receptor family and the TrpV subfamily. The calcium-selective channel encoded by this gene has 6 transmembrane-spanning domains, multiple potential phosphorylation sites, an N-linked glycosylation site, and 5 ANK repeats. This protein forms homotetramers or heterotetramers and is activated by a low internal calcium level. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit increased calcium excretion and reduced bone thickenss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Trpv5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Trpv5 APN 6 41675375 missense possibly damaging 0.87
IGL01704:Trpv5 APN 6 41653258 missense possibly damaging 0.88
IGL01860:Trpv5 APN 6 41660295 missense probably damaging 1.00
IGL01950:Trpv5 APN 6 41675978 missense probably benign 0.09
Firesign UTSW 6 41658042 missense probably damaging 1.00
gingame UTSW 6 41670961 missense probably damaging 1.00
R0515:Trpv5 UTSW 6 41674211 intron probably benign
R1581:Trpv5 UTSW 6 41653140 missense probably damaging 1.00
R1633:Trpv5 UTSW 6 41675920 nonsense probably null
R1658:Trpv5 UTSW 6 41674282 missense probably damaging 1.00
R1677:Trpv5 UTSW 6 41657797 missense probably benign 0.44
R1955:Trpv5 UTSW 6 41657937 missense probably damaging 1.00
R2008:Trpv5 UTSW 6 41659728 critical splice acceptor site probably null
R2331:Trpv5 UTSW 6 41659968 missense probably damaging 1.00
R2519:Trpv5 UTSW 6 41674350 missense probably damaging 0.99
R2973:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R2974:Trpv5 UTSW 6 41653231 missense possibly damaging 0.81
R3923:Trpv5 UTSW 6 41653249 missense probably benign 0.00
R4056:Trpv5 UTSW 6 41659705 missense probably damaging 1.00
R4396:Trpv5 UTSW 6 41657896 missense probably benign 0.00
R4757:Trpv5 UTSW 6 41653214 missense probably damaging 0.98
R5013:Trpv5 UTSW 6 41659713 missense probably damaging 1.00
R5039:Trpv5 UTSW 6 41675945 missense possibly damaging 0.73
R5330:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R5331:Trpv5 UTSW 6 41660332 missense probably benign 0.06
R6270:Trpv5 UTSW 6 41674359 missense possibly damaging 0.94
R6405:Trpv5 UTSW 6 41674668 missense probably damaging 1.00
R6575:Trpv5 UTSW 6 41675969 missense probably benign
R6669:Trpv5 UTSW 6 41658042 missense probably damaging 1.00
R6681:Trpv5 UTSW 6 41653354 missense probably damaging 0.97
R6817:Trpv5 UTSW 6 41658007 missense possibly damaging 0.65
R7021:Trpv5 UTSW 6 41653270 missense probably benign 0.00
R7069:Trpv5 UTSW 6 41675960 missense possibly damaging 0.94
R7161:Trpv5 UTSW 6 41660536 nonsense probably null
R7241:Trpv5 UTSW 6 41675308 nonsense probably null
R7505:Trpv5 UTSW 6 41674656 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGCCAAGTCTTAACAGCTG -3'
(R):5'- AGCATATGTGACTTACCAGGATAAG -3'

Sequencing Primer
(F):5'- GGCCAAGTCTTAACAGCTGAAACAC -3'
(R):5'- GATAAGATCCGGCTGGTCG -3'
Posted On2015-04-06