Incidental Mutation 'R3877:Vrk3'
ID276906
Institutional Source Beutler Lab
Gene Symbol Vrk3
Ensembl Gene ENSMUSG00000002205
Gene Namevaccinia related kinase 3
Synonyms
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44748413-44777515 bp(+) (GRCm38)
Type of Mutationunclassified (3267 bp from exon)
DNA Base Change (assembly) A to T at 44763036 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002275] [ENSMUST00000144515] [ENSMUST00000147952] [ENSMUST00000165957] [ENSMUST00000171821]
Predicted Effect probably null
Transcript: ENSMUST00000002275
AA Change: R199*
SMART Domains Protein: ENSMUSP00000002275
Gene: ENSMUSG00000002205
AA Change: R199*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 212 432 3.2e-8 PFAM
Pfam:Pkinase 218 432 4.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135783
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136069
Predicted Effect probably null
Transcript: ENSMUST00000144515
AA Change: R134*
SMART Domains Protein: ENSMUSP00000119073
Gene: ENSMUSG00000002205
AA Change: R134*

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.2e-11 PFAM
Pfam:zinc_ribbon_2 4 26 3e-10 PFAM
PDB:2JII|B 97 176 3e-36 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000147952
SMART Domains Protein: ENSMUSP00000130331
Gene: ENSMUSG00000002205

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 1.1e-11 PFAM
Pfam:zinc_ribbon_2 4 26 2.9e-10 PFAM
PDB:2JII|B 117 162 1e-8 PDB
Predicted Effect probably null
Transcript: ENSMUST00000165957
AA Change: R199*
SMART Domains Protein: ENSMUSP00000131704
Gene: ENSMUSG00000002205
AA Change: R199*

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 6.7e-12 PFAM
Pfam:zinc_ribbon_2 4 26 4.4e-10 PFAM
PDB:2JII|B 117 204 7e-30 PDB
Predicted Effect probably null
Transcript: ENSMUST00000171821
SMART Domains Protein: ENSMUSP00000132748
Gene: ENSMUSG00000002205

DomainStartEndE-ValueType
Pfam:zf-ribbon_3 1 26 2.9e-12 PFAM
Pfam:zinc_ribbon_2 4 26 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208083
Meta Mutation Damage Score 0.6272 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. In both human and mouse, this gene has substitutions at several residues within the ATP binding motifs that in other kinases have been shown to be required for catalysis. In vitro assays indicate the protein lacks phosphorylation activity. The protein, however, likely retains its substrate binding capability. This gene is widely expressed in human tissues and its protein localizes to the nucleus. Alternative splicing results in multiple transcripts encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired social behavior, decreased fear and anxiety relate behavior, impaired spatial memory, and abnormal hippocampal dendritic spine and synapse morphologies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Vrk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Vrk3 APN 7 44769647 missense probably damaging 1.00
IGL01540:Vrk3 APN 7 44767144 missense probably damaging 1.00
IGL02682:Vrk3 APN 7 44753820 missense probably benign 0.19
R0462:Vrk3 UTSW 7 44764200 missense possibly damaging 0.77
R0831:Vrk3 UTSW 7 44764803 missense probably damaging 1.00
R1760:Vrk3 UTSW 7 44768471 missense probably damaging 0.98
R2212:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2289:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R2915:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3027:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3028:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3416:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3417:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R3613:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4357:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4359:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4379:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4381:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4439:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4441:Vrk3 UTSW 7 44775442 missense probably benign 0.00
R4773:Vrk3 UTSW 7 44775476 missense probably benign
R5222:Vrk3 UTSW 7 44759796 missense possibly damaging 0.67
R5808:Vrk3 UTSW 7 44759874 missense probably damaging 0.96
R6180:Vrk3 UTSW 7 44769611 missense possibly damaging 0.50
R7007:Vrk3 UTSW 7 44757763 missense probably damaging 0.97
R7058:Vrk3 UTSW 7 44768466 missense probably damaging 0.98
R7425:Vrk3 UTSW 7 44770924 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAACTGGATCTGGTGTAGGAC -3'
(R):5'- CAGCACACAGTGTTCATGACAG -3'

Sequencing Primer
(F):5'- CTGGATCTGGTGTAGGACAGGAAG -3'
(R):5'- TCTTAAGAGCTGCTACAGGC -3'
Posted On2015-04-06