Incidental Mutation 'R3877:Idh3a'
ID276910
Institutional Source Beutler Lab
Gene Symbol Idh3a
Ensembl Gene ENSMUSG00000032279
Gene Nameisocitrate dehydrogenase 3 (NAD+) alpha
Synonyms
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54586334-54604661 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54592395 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 31 (V31A)
Ref Sequence ENSEMBL: ENSMUSP00000127526 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167866] [ENSMUST00000215273] [ENSMUST00000217484]
Predicted Effect probably benign
Transcript: ENSMUST00000167866
AA Change: V31A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127526
Gene: ENSMUSG00000032279
AA Change: V31A

DomainStartEndE-ValueType
Iso_dh 33 358 1.37e-169 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214136
Predicted Effect probably benign
Transcript: ENSMUST00000215273
Predicted Effect probably benign
Transcript: ENSMUST00000217484
AA Change: V49A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.112 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the alpha subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive retinal degeneration and decreased visual acuity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Idh3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Idh3a APN 9 54601222 splice site probably benign
IGL02547:Idh3a APN 9 54592395 missense probably benign 0.00
IGL02593:Idh3a APN 9 54596193 splice site probably benign
IGL03408:Idh3a APN 9 54596922 missense probably benign 0.00
ANU23:Idh3a UTSW 9 54586545 critical splice donor site probably null
R2496:Idh3a UTSW 9 54603349 missense probably benign 0.20
R3709:Idh3a UTSW 9 54586526 missense possibly damaging 0.83
R4962:Idh3a UTSW 9 54596041 missense possibly damaging 0.86
R6054:Idh3a UTSW 9 54586545 critical splice donor site probably benign
R7246:Idh3a UTSW 9 54592472 missense probably damaging 1.00
R7426:Idh3a UTSW 9 54601208 missense probably benign
R7450:Idh3a UTSW 9 54596083 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGAGTTGGATTCTGCCTC -3'
(R):5'- TGCAGTTATTCATTTCTGTGCATAC -3'

Sequencing Primer
(F):5'- CTGCCTCTGTCAAGATCAAAGTGAG -3'
(R):5'- CTCAGATCATTATGCTGGGCAAG -3'
Posted On2015-04-06