Incidental Mutation 'R3877:Inf2'
ID276917
Institutional Source Beutler Lab
Gene Symbol Inf2
Ensembl Gene ENSMUSG00000037679
Gene Nameinverted formin, FH2 and WH2 domain containing
Synonyms2610204M08Rik, EG629699
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112588784-112615557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112610830 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1036 (A1036E)
Ref Sequence ENSEMBL: ENSMUSP00000098591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101029]
Predicted Effect unknown
Transcript: ENSMUST00000101029
AA Change: A1036E
SMART Domains Protein: ENSMUSP00000098591
Gene: ENSMUSG00000037679
AA Change: A1036E

DomainStartEndE-ValueType
Drf_GBD 1 152 3.47e-34 SMART
Drf_FH3 156 343 2.18e-58 SMART
low complexity region 359 382 N/A INTRINSIC
low complexity region 420 518 N/A INTRINSIC
low complexity region 525 557 N/A INTRINSIC
FH2 587 1030 1.96e-53 SMART
WH2 1005 1020 1.68e-2 SMART
Blast:FH2 1049 1179 3e-28 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000222275
AA Change: A493E
Meta Mutation Damage Score 0.0532 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display placental vasculopathy, restricted fetal growth, increased gestational length and transient increase in maternal blood pressure in the late stages of pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Angptl4 G A 17: 33,777,034 P323S possibly damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Inf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Inf2 APN 12 112611856 nonsense probably null
IGL01582:Inf2 APN 12 112610559 missense unknown
IGL02078:Inf2 APN 12 112601614 missense probably damaging 1.00
IGL02534:Inf2 APN 12 112610496 missense unknown
IGL03122:Inf2 APN 12 112604229 missense probably benign 0.03
IGL03296:Inf2 APN 12 112604208 nonsense probably null
Talon UTSW 12 112610287 splice site probably benign
R0413:Inf2 UTSW 12 112601676 missense probably damaging 1.00
R0552:Inf2 UTSW 12 112612574 intron probably benign
R0920:Inf2 UTSW 12 112610287 splice site probably benign
R1240:Inf2 UTSW 12 112610776 missense unknown
R1452:Inf2 UTSW 12 112601344 missense probably damaging 0.99
R1974:Inf2 UTSW 12 112608337 missense unknown
R2422:Inf2 UTSW 12 112610824 missense unknown
R4108:Inf2 UTSW 12 112607581 missense unknown
R4490:Inf2 UTSW 12 112600204 missense probably damaging 1.00
R5071:Inf2 UTSW 12 112612039 splice site probably null
R5074:Inf2 UTSW 12 112612039 splice site probably null
R5306:Inf2 UTSW 12 112601553 missense probably benign 0.26
R5383:Inf2 UTSW 12 112600145 missense probably damaging 0.99
R5569:Inf2 UTSW 12 112601679 missense possibly damaging 0.80
R5664:Inf2 UTSW 12 112611728 missense unknown
R6157:Inf2 UTSW 12 112604788 unclassified probably benign
R6221:Inf2 UTSW 12 112603745 missense possibly damaging 0.66
R6429:Inf2 UTSW 12 112604256 missense probably benign 0.01
R6955:Inf2 UTSW 12 112610731 missense unknown
R7423:Inf2 UTSW 12 112609738 missense unknown
R7444:Inf2 UTSW 12 112605387 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGCTCTCTAAGGTCTGTGG -3'
(R):5'- AATGTTTAAGAGAGGCACAGTCC -3'

Sequencing Primer
(F):5'- CTAAGGTCTGTGGCTCTGCTC -3'
(R):5'- CATAGGCCAATTTCAGAGTTGTGCC -3'
Posted On2015-04-06