Incidental Mutation 'R3877:Angptl4'
ID276922
Institutional Source Beutler Lab
Gene Symbol Angptl4
Ensembl Gene ENSMUSG00000002289
Gene Nameangiopoietin-like 4
SynonymsFIAF, BK89, NG27, HFARP
MMRRC Submission 040904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3877 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33773750-33781575 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33777034 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 323 (P323S)
Ref Sequence ENSEMBL: ENSMUSP00000002360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002360] [ENSMUST00000173869]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002360
AA Change: P323S

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000002360
Gene: ENSMUSG00000002289
AA Change: P323S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 151 N/A INTRINSIC
FBG 187 404 6.6e-69 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173869
SMART Domains Protein: ENSMUSP00000133417
Gene: ENSMUSG00000002289

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
coiled coil region 104 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174872
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.2%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display decreased levels of triglycerides and cholesterol and a lower increase in body fat after exposure to gut microbiota. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,221,943 S1900P probably benign Het
Adam20 G A 8: 40,796,634 V594I possibly damaging Het
Adgb A T 10: 10,442,483 probably null Het
Adgrb3 A C 1: 25,111,825 L1109R probably damaging Het
Arhgap21 A T 2: 20,859,906 M1197K probably damaging Het
Arhgef40 A G 14: 52,002,285 T1319A probably damaging Het
C4bp A G 1: 130,648,027 probably null Het
Cd200r1 T C 16: 44,790,011 S161P probably damaging Het
Ckap5 A G 2: 91,615,150 K1711E possibly damaging Het
Cldn19 T C 4: 119,256,897 S79P possibly damaging Het
Dnah17 T G 11: 118,024,707 N4334T probably damaging Het
Dpm2 G A 2: 32,572,400 probably null Het
Eef1a2 A T 2: 181,152,833 V191E probably damaging Het
Gmds G A 13: 32,227,265 T62I probably damaging Het
Hyal5 A T 6: 24,876,631 I168F probably damaging Het
Idh3a T C 9: 54,592,395 V31A probably benign Het
Inf2 C A 12: 112,610,830 A1036E unknown Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kidins220 T A 12: 25,001,565 probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b A G 2: 41,445,194 C779R probably damaging Het
Lrp2 A G 2: 69,459,472 probably null Het
Lrp2 G A 2: 69,549,047 T107M probably damaging Het
Lrpap1 T C 5: 35,098,203 E184G probably benign Het
Mapre1 C T 2: 153,746,281 T8M possibly damaging Het
Mms19 G A 19: 41,966,256 Q75* probably null Het
Mtcl1 T C 17: 66,342,954 I1390V probably damaging Het
Muc5b A G 7: 141,857,552 S1412G unknown Het
Myh4 A T 11: 67,257,183 Q1686L probably benign Het
Olfr12 A T 1: 92,620,083 D59V probably damaging Het
Olfr384 A T 11: 73,603,153 D191V probably damaging Het
Rcvrn A T 11: 67,699,976 I129F probably damaging Het
Reg3b T A 6: 78,371,233 M10K possibly damaging Het
Rimbp2 T A 5: 128,773,465 E918V probably damaging Het
Rpl5 A G 5: 107,903,801 T154A probably benign Het
Sall4 A C 2: 168,756,242 L195R probably damaging Het
Sh3gl2 T C 4: 85,379,381 S199P possibly damaging Het
Shank1 G T 7: 44,344,992 R859L unknown Het
Thsd7b A G 1: 130,190,182 E1445G possibly damaging Het
Tnfaip6 A G 2: 52,052,327 E216G probably benign Het
Tram1 T C 1: 13,569,603 T307A probably benign Het
Trpv5 A G 6: 41,660,343 V354A probably benign Het
Tyro3 A G 2: 119,813,293 E745G probably damaging Het
Vmn1r68 A T 7: 10,527,481 I230N probably damaging Het
Vmn2r28 A T 7: 5,488,358 W297R probably damaging Het
Vrk3 A T 7: 44,763,036 probably null Het
Zfhx4 T C 3: 5,400,785 V2001A probably benign Het
Zfp512b AG AGG 2: 181,588,763 probably null Het
Other mutations in Angptl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Angptl4 APN 17 33781268 missense probably damaging 1.00
R0117:Angptl4 UTSW 17 33780802 missense probably damaging 1.00
R1225:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1491:Angptl4 UTSW 17 33781191 missense possibly damaging 0.73
R1932:Angptl4 UTSW 17 33781275 nonsense probably null
R2055:Angptl4 UTSW 17 33780524 splice site probably null
R2212:Angptl4 UTSW 17 33775418 missense probably damaging 0.99
R2959:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R2963:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3881:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R3882:Angptl4 UTSW 17 33777034 missense possibly damaging 0.54
R4646:Angptl4 UTSW 17 33781299 missense probably benign 0.00
R4660:Angptl4 UTSW 17 33777275 intron probably benign
R6192:Angptl4 UTSW 17 33777041 missense probably benign 0.09
R6591:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R6691:Angptl4 UTSW 17 33780781 critical splice donor site probably null
R7350:Angptl4 UTSW 17 33777110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGCTCTGTGCCAGAATG -3'
(R):5'- TGCACAGCATCACAGGGAAC -3'

Sequencing Primer
(F):5'- TTCAATGACTGGCCCATAGG -3'
(R):5'- ACCGAGGAAGCCAATTGG -3'
Posted On2015-04-06