Mutagenetix > Incidental Mutations

Incidental Mutation 'R3878:Nebl'

276929

Institutional Source

Beutler Lab

Gene Symbol

Nebl

Ensembl Gene

ENSMUSG00000053702

Gene Name

nebulette

Synonyms

Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.184) question?

Stock #

R3878 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

17343909-17731464 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17393252 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 457 (T457A)

Ref Sequence

ENSEMBL: ENSMUSP00000118525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492] [ENSMUST00000177966]

Predicted Effect

probably benign
Transcript: ENSMUST00000028080

SMART Domains

Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
LIM	4	56	6.95e-14	SMART
NEBU	62	92	3.35e-8	SMART
NEBU	98	128	4.88e-10	SMART
NEBU	134	164	3.82e-3	SMART
SH3	213	270	2.12e-20	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000124270
AA Change: T492A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: T492A

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	1.57e0	SMART
NEBU	280	310	9.67e-1	SMART
NEBU	315	345	6.25e-8	SMART
NEBU	351	381	5.97e-5	SMART
NEBU	387	418	2.56e-4	SMART
NEBU	425	455	8.91e-4	SMART
NEBU	462	492	4.92e-6	SMART
NEBU	499	529	2.33e-7	SMART
NEBU	536	566	1.84e-5	SMART
NEBU	571	601	2.23e-4	SMART
NEBU	602	632	1.24e-2	SMART
NEBU	664	694	6.6e-7	SMART
NEBU	695	725	6.86e-5	SMART
NEBU	726	756	2.03e-7	SMART
NEBU	761	791	1.74e-6	SMART
NEBU	797	827	3.82e-3	SMART
SH3	957	1014	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124611

SMART Domains

Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	3	33	4.88e-10	SMART
NEBU	39	69	3.82e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127912

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131957
AA Change: T457A

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: T457A

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	7.35e0	SMART
NEBU	280	310	6.25e-8	SMART
NEBU	316	346	5.97e-5	SMART
NEBU	352	383	2.56e-4	SMART
NEBU	390	420	8.91e-4	SMART
NEBU	427	457	4.92e-6	SMART
NEBU	464	494	2.33e-7	SMART
NEBU	501	525	1.02e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000132418
AA Change: T420A

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702
AA Change: T420A

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	7.35e0	SMART
NEBU	280	310	6.25e-8	SMART
NEBU	316	346	5.97e-5	SMART
NEBU	352	383	2.56e-4	SMART
NEBU	390	420	4.78e-4	SMART
NEBU	427	450	6.81e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137253

Predicted Effect

probably benign
Transcript: ENSMUST00000145492

SMART Domains

Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	7.35e0	SMART
NEBU	280	310	6.25e-8	SMART
NEBU	316	346	5.97e-5	SMART
NEBU	352	383	2.56e-4	SMART
NEBU	390	420	8.91e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150194

Predicted Effect

probably benign
Transcript: ENSMUST00000177966

SMART Domains

Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	5	35	2.23e-4	SMART
NEBU	36	66	3.28e-2	SMART
NEBU	67	97	6.6e-7	SMART
NEBU	98	120	2e1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020A23Rik	C	T	2: 130,405,640	T32M	probably benign	Het
4930402H24Rik	T	C	2: 130,778,503	R237G	possibly damaging	Het
A2ml1	T	C	6: 128,554,361	S915G	probably benign	Het
Ablim1	T	C	19: 57,037,210		probably null	Het
Cadm2	C	T	16: 66,815,441	E78K	probably damaging	Het
Ceacam5	C	T	7: 17,750,581	P416L	probably damaging	Het
Chsy3	T	C	18: 59,409,773	F661S	probably damaging	Het
Clstn3	G	A	6: 124,457,942	T338I	probably damaging	Het
Ctif	A	G	18: 75,519,977	I403T	probably damaging	Het
Eprs	T	A	1: 185,415,953		probably null	Het
Fam214b	T	G	4: 43,035,867	H288P	probably damaging	Het
Frs2	A	C	10: 117,078,910	S35A	probably benign	Het
Gpr155	C	T	2: 73,368,392	W394*	probably null	Het
Ift140	G	A	17: 25,028,944	V259M	probably benign	Het
Igkv9-124	A	T	6: 67,942,207	S74T	probably benign	Het
Krt14	C	T	11: 100,207,089	V123M	possibly damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Nlrp4g	A	G	9: 124,349,362		noncoding transcript	Het
Nsa2	C	G	13: 97,132,034	G175A	probably benign	Het
Olfr1090	T	C	2: 86,754,628	T37A	probably benign	Het
Pax1	A	T	2: 147,362,308		probably benign	Het
Pdzd2	T	C	15: 12,376,176	E1291G	probably benign	Het
Relb	G	A	7: 19,617,844	H115Y	probably damaging	Het
Rnase10	A	G	14: 51,009,432	E52G	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc14a2	C	T	18: 78,159,074	V614I	probably benign	Het
Slc20a2	T	C	8: 22,568,383	L645P	possibly damaging	Het
Smoc2	A	G	17: 14,325,617	D56G	probably damaging	Het
Szt2	A	G	4: 118,390,585	S789P	probably damaging	Het
Tenm2	A	G	11: 36,139,574		probably null	Het
Tm9sf3	A	G	19: 41,246,713	V169A	probably damaging	Het
Trbv13-1	C	T	6: 41,116,388	T86I	probably benign	Het
Trim24	A	G	6: 37,964,773	D886G	probably benign	Het
Trim33	A	G	3: 103,352,005	I1003M	probably damaging	Het
Trim37	T	C	11: 87,206,002	V777A	probably benign	Het
Ttc7	A	C	17: 87,370,738		probably benign	Het
Ttn	T	C	2: 76,766,020	D11856G	possibly damaging	Het
Vmn1r226	A	T	17: 20,687,998	D164V	possibly damaging	Het
Vmn1r34	G	A	6: 66,637,568	T62I	possibly damaging	Het
Wapl	T	C	14: 34,692,147	L322P	probably damaging	Het
Zfp62	A	G	11: 49,215,133	D17G	probably damaging	Het

Other mutations in Nebl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02146:Nebl	APN	2	17348868	missense	probably damaging	0.99
IGL02732:Nebl	APN	2	17452484	splice site	probably benign
IGL03241:Nebl	APN	2	17393164	critical splice donor site	probably null
IGL03334:Nebl	APN	2	17413711	missense	probably damaging	0.98
R0068:Nebl	UTSW	2	17434971	nonsense	probably null
R0127:Nebl	UTSW	2	17392983	missense	probably benign	0.31
R0128:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17390926	start gained	probably benign
R0130:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0537:Nebl	UTSW	2	17404215	missense	possibly damaging	0.62
R0743:Nebl	UTSW	2	17411118	missense	probably benign
R0884:Nebl	UTSW	2	17411118	missense	probably benign
R1364:Nebl	UTSW	2	17393037	unclassified	probably benign
R1638:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R1711:Nebl	UTSW	2	17388754	missense	probably damaging	0.96
R1933:Nebl	UTSW	2	17375292	missense	probably damaging	0.97
R1990:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1991:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1992:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R2062:Nebl	UTSW	2	17397121	missense	probably benign	0.39
R2183:Nebl	UTSW	2	17404216	missense	probably damaging	0.99
R2325:Nebl	UTSW	2	17393016	missense	possibly damaging	0.79
R2679:Nebl	UTSW	2	17424591	missense	probably benign	0.03
R2877:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R2878:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R3079:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3080:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3947:Nebl	UTSW	2	17378106	critical splice donor site	probably null
R4983:Nebl	UTSW	2	17375271	missense	possibly damaging	0.80
R5006:Nebl	UTSW	2	17388771	unclassified	probably null
R5256:Nebl	UTSW	2	17433975	missense	probably benign	0.37
R5491:Nebl	UTSW	2	17434972	nonsense	probably null
R5533:Nebl	UTSW	2	17393268	nonsense	probably null
R5597:Nebl	UTSW	2	17378167	missense	probably benign
R5658:Nebl	UTSW	2	17348852	missense	probably damaging	1.00
R5933:Nebl	UTSW	2	17404187	missense	probably benign
R6056:Nebl	UTSW	2	17450234	missense	probably benign	0.13
R6161:Nebl	UTSW	2	17730830	missense	probably benign	0.26
R6646:Nebl	UTSW	2	17376685	missense	probably damaging	1.00
R6784:Nebl	UTSW	2	17434914	nonsense	probably null
R6935:Nebl	UTSW	2	17348826	missense	probably damaging	1.00
X0012:Nebl	UTSW	2	17443794	missense	probably benign	0.16
X0025:Nebl	UTSW	2	17404267	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGGGTCCTATTGTTATTCATG -3'
(R):5'- TTAGTACACAAAGCCTCCTGGTTATG -3'

Sequencing Primer
(F):5'- CATGTGTTTCAACAACAAGGTGAC -3'
(R):5'- GTCCTGATGTCAAAATGACA -3'

Posted On

2015-04-06