Incidental Mutation 'R3878:Olfr1090'
ID276932
Institutional Source Beutler Lab
Gene Symbol Olfr1090
Ensembl Gene ENSMUSG00000075172
Gene Nameolfactory receptor 1090
SynonymsGA_x6K02T2Q125-48247345-48246404, MOR188-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location86752724-86758993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86754628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 37 (T37A)
Ref Sequence ENSEMBL: ENSMUSP00000149968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099875] [ENSMUST00000215991] [ENSMUST00000217043]
Predicted Effect probably benign
Transcript: ENSMUST00000099875
AA Change: T37A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000097460
Gene: ENSMUSG00000075172
AA Change: T37A

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-47 PFAM
Pfam:7tm_1 41 290 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215991
AA Change: T37A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000217043
AA Change: T37A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Olfr1090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Olfr1090 APN 2 86753970 missense probably benign 0.42
IGL01343:Olfr1090 APN 2 86754499 nonsense probably null
IGL01431:Olfr1090 APN 2 86754164 missense probably benign 0.12
IGL01771:Olfr1090 APN 2 86754282 missense probably benign 0.15
IGL03182:Olfr1090 APN 2 86754022 missense probably damaging 1.00
IGL03229:Olfr1090 APN 2 86754016 missense probably damaging 1.00
R0126:Olfr1090 UTSW 2 86754637 missense probably damaging 0.99
R0128:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R0130:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R1383:Olfr1090 UTSW 2 86754494 missense possibly damaging 0.80
R2100:Olfr1090 UTSW 2 86754561 missense possibly damaging 0.80
R2125:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2126:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2249:Olfr1090 UTSW 2 86754054 missense probably damaging 0.98
R3695:Olfr1090 UTSW 2 86753871 missense probably damaging 1.00
R3940:Olfr1090 UTSW 2 86753931 missense possibly damaging 0.52
R3944:Olfr1090 UTSW 2 86754181 missense probably benign 0.17
R3975:Olfr1090 UTSW 2 86754543 missense probably damaging 0.99
R4387:Olfr1090 UTSW 2 86754120 missense probably benign 0.42
R4623:Olfr1090 UTSW 2 86754562 missense possibly damaging 0.80
R4740:Olfr1090 UTSW 2 86753811 missense probably benign 0.00
R6775:Olfr1090 UTSW 2 86754577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAAGCTAGTTGTGTGGCAC -3'
(R):5'- GCCAAGTATGTAAGAGCTATTCACTG -3'

Sequencing Primer
(F):5'- TGTGGCACAAAGATTAAATGAAATTG -3'
(R):5'- GAAGGAACACAATCTCACAG -3'
Posted On2015-04-06