Incidental Mutation 'R3878:A2ml1'
ID276943
Institutional Source Beutler Lab
Gene Symbol A2ml1
Ensembl Gene ENSMUSG00000047228
Gene Namealpha-2-macroglobulin like 1
Synonyms
Accession Numbers

Genbank: NM_001001179.3; Ensembl: ENSMUST00000060574

Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128539821-128581608 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 128554361 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 915 (S915G)
Ref Sequence ENSEMBL: ENSMUSP00000059426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060574]
Predicted Effect probably benign
Transcript: ENSMUST00000060574
AA Change: S915G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059426
Gene: ENSMUSG00000047228
AA Change: S915G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
Pfam:A2M_N 120 213 6.3e-17 PFAM
A2M_N_2 448 594 2.95e-37 SMART
A2M 736 826 2.11e-33 SMART
Pfam:Thiol-ester_cl 959 988 3.1e-17 PFAM
Pfam:A2M_comp 1008 1255 2.3e-71 PFAM
A2M_recep 1361 1447 1.22e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205167
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in A2ml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:A2ml1 APN 6 128578156 missense possibly damaging 0.78
IGL00596:A2ml1 APN 6 128570067 missense probably damaging 0.99
IGL00912:A2ml1 APN 6 128552307 missense probably benign 0.04
IGL01320:A2ml1 APN 6 128575588 missense probably benign 0.00
IGL01470:A2ml1 APN 6 128580412 missense probably damaging 0.96
IGL01576:A2ml1 APN 6 128554330 splice site probably benign
IGL01761:A2ml1 APN 6 128546337 missense possibly damaging 0.61
IGL01792:A2ml1 APN 6 128560679 missense probably benign 0.04
IGL01843:A2ml1 APN 6 128553338 splice site probably benign
IGL01946:A2ml1 APN 6 128570479 missense possibly damaging 0.81
IGL02016:A2ml1 APN 6 128558335 missense probably damaging 1.00
IGL02170:A2ml1 APN 6 128547210 missense possibly damaging 0.58
IGL02269:A2ml1 APN 6 128553338 splice site probably benign
IGL02589:A2ml1 APN 6 128581500 missense probably benign 0.00
IGL02959:A2ml1 APN 6 128567060 missense probably benign 0.04
IGL02970:A2ml1 APN 6 128569979 missense probably damaging 1.00
IGL03206:A2ml1 APN 6 128553276 missense possibly damaging 0.50
IGL03298:A2ml1 APN 6 128543960 missense probably benign 0.00
1mM(1):A2ml1 UTSW 6 128580960 missense probably benign 0.02
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0055:A2ml1 UTSW 6 128570094 splice site probably benign
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0069:A2ml1 UTSW 6 128561562 missense probably damaging 1.00
R0128:A2ml1 UTSW 6 128575639 splice site probably benign
R0299:A2ml1 UTSW 6 128553232 splice site probably benign
R0523:A2ml1 UTSW 6 128558326 missense possibly damaging 0.92
R0565:A2ml1 UTSW 6 128568743 nonsense probably null
R0599:A2ml1 UTSW 6 128552245 missense probably damaging 1.00
R0626:A2ml1 UTSW 6 128550773 missense probably damaging 0.99
R0732:A2ml1 UTSW 6 128546448 missense probably damaging 1.00
R0880:A2ml1 UTSW 6 128560646 missense possibly damaging 0.49
R1070:A2ml1 UTSW 6 128543300 missense probably damaging 1.00
R1166:A2ml1 UTSW 6 128570917 missense probably benign 0.00
R1278:A2ml1 UTSW 6 128558507 missense probably damaging 1.00
R1421:A2ml1 UTSW 6 128543960 missense probably benign 0.00
R1536:A2ml1 UTSW 6 128547233 nonsense probably null
R1786:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R1808:A2ml1 UTSW 6 128543299 missense probably damaging 1.00
R1813:A2ml1 UTSW 6 128566273 missense probably benign 0.34
R1863:A2ml1 UTSW 6 128550783 missense probably damaging 0.99
R2007:A2ml1 UTSW 6 128542892 missense probably benign 0.13
R2062:A2ml1 UTSW 6 128552308 missense probably benign 0.08
R2127:A2ml1 UTSW 6 128558437 missense probably damaging 1.00
R2130:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2131:A2ml1 UTSW 6 128576260 missense probably damaging 1.00
R2201:A2ml1 UTSW 6 128547305 missense probably null 0.34
R2319:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2321:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2322:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2369:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2370:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2371:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2372:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2375:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2893:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R2894:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3438:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R3615:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3616:A2ml1 UTSW 6 128558294 missense probably benign 0.07
R3773:A2ml1 UTSW 6 128555083 missense probably benign 0.02
R3785:A2ml1 UTSW 6 128544924 critical splice donor site probably null
R3803:A2ml1 UTSW 6 128545070 missense probably benign 0.17
R3824:A2ml1 UTSW 6 128568763 missense probably damaging 0.99
R4176:A2ml1 UTSW 6 128545037 missense possibly damaging 0.68
R4229:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4230:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4348:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4351:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4352:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4353:A2ml1 UTSW 6 128580386 missense probably benign 0.01
R4427:A2ml1 UTSW 6 128545046 missense probably benign 0.00
R4971:A2ml1 UTSW 6 128547227 missense probably damaging 0.98
R5014:A2ml1 UTSW 6 128543933 missense probably benign 0.00
R5369:A2ml1 UTSW 6 128568833 missense probably damaging 0.97
R5532:A2ml1 UTSW 6 128553330 critical splice acceptor site probably null
R5860:A2ml1 UTSW 6 128541061 missense probably benign 0.15
R5872:A2ml1 UTSW 6 128561526 missense probably damaging 1.00
R5926:A2ml1 UTSW 6 128560645 missense probably benign
R5977:A2ml1 UTSW 6 128581122 missense probably damaging 1.00
R5980:A2ml1 UTSW 6 128567055 missense possibly damaging 0.82
R6014:A2ml1 UTSW 6 128571985 missense probably damaging 1.00
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6032:A2ml1 UTSW 6 128549836 nonsense probably null
R6061:A2ml1 UTSW 6 128568712 missense probably damaging 1.00
R6327:A2ml1 UTSW 6 128558692 unclassified probably null
R6331:A2ml1 UTSW 6 128552236 missense probably damaging 0.96
R6465:A2ml1 UTSW 6 128541078 missense probably damaging 1.00
R6640:A2ml1 UTSW 6 128553285 missense probably benign 0.41
R6792:A2ml1 UTSW 6 128546329 nonsense probably null
R6793:A2ml1 UTSW 6 128546329 nonsense probably null
X0063:A2ml1 UTSW 6 128572012 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATTGGCCAAGATTGTGAGAC -3'
(R):5'- CCTTGCACAACCAATGGGAG -3'

Sequencing Primer
(F):5'- AGGTTGTGGAAAACTAATCTCATTAG -3'
(R):5'- ATGTGGTGTACAGAGACTTCTACC -3'
Posted On2015-04-06