Incidental Mutation 'R3878:Relb'
ID276945
Institutional Source Beutler Lab
Gene Symbol Relb
Ensembl Gene ENSMUSG00000002983
Gene Nameavian reticuloendotheliosis viral (v-rel) oncogene related B
Synonymsshep
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.832) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19606217-19629438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 19617844 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 115 (H115Y)
Ref Sequence ENSEMBL: ENSMUSP00000146669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049912] [ENSMUST00000094762] [ENSMUST00000098754] [ENSMUST00000141586] [ENSMUST00000153309] [ENSMUST00000208087]
Predicted Effect probably damaging
Transcript: ENSMUST00000049912
AA Change: H169Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050166
Gene: ENSMUSG00000002983
AA Change: H169Y

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 73 82 N/A INTRINSIC
Pfam:RHD 102 270 1.3e-65 PFAM
IPT 277 373 1.26e-24 SMART
low complexity region 449 464 N/A INTRINSIC
low complexity region 478 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094762
AA Change: H172Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092355
Gene: ENSMUSG00000002983
AA Change: H172Y

DomainStartEndE-ValueType
Pfam:RelB_leu_zip 1 84 1.2e-43 PFAM
Pfam:RHD_DNA_bind 105 273 3.7e-66 PFAM
IPT 280 376 1.26e-24 SMART
Pfam:RelB_transactiv 381 558 3.2e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098754
AA Change: H172Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096350
Gene: ENSMUSG00000002983
AA Change: H172Y

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 76 85 N/A INTRINSIC
Pfam:RHD 105 273 3.7e-66 PFAM
IPT 280 376 1.26e-24 SMART
low complexity region 452 467 N/A INTRINSIC
low complexity region 481 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137615
Predicted Effect probably damaging
Transcript: ENSMUST00000141586
AA Change: H115Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148040
Predicted Effect probably damaging
Transcript: ENSMUST00000153309
AA Change: H115Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208087
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutant homozygotes die prematurely with phenotypes including inflammatory cell infiltration of organs, myeloid hyperplasia, splenomegaly, reduction in thymic dendritic cells, impaired cellular immunity, hyperkeratosis, epidermal hyperplasia, or hepatitiswith mononuclear infiltration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Relb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Relb APN 7 19622924 critical splice donor site probably null
IGL00661:Relb APN 7 19616411 missense possibly damaging 0.92
IGL01338:Relb APN 7 19616373 missense probably benign 0.03
IGL01340:Relb APN 7 19616373 missense probably benign 0.03
IGL01341:Relb APN 7 19616373 missense probably benign 0.03
IGL01576:Relb APN 7 19612601 missense probably benign 0.07
IGL01672:Relb APN 7 19611694 missense probably benign 0.44
IGL01953:Relb APN 7 19615557 critical splice donor site probably null
IGL02792:Relb APN 7 19613864 missense probably damaging 1.00
IGL03117:Relb APN 7 19612657 missense probably damaging 1.00
R0940:Relb UTSW 7 19611842 missense probably damaging 1.00
R2164:Relb UTSW 7 19613761 unclassified probably null
R4747:Relb UTSW 7 19627922 critical splice donor site probably null
R4795:Relb UTSW 7 19619839 missense probably damaging 1.00
R4996:Relb UTSW 7 19615603 missense probably benign 0.01
R5330:Relb UTSW 7 19606705 missense possibly damaging 0.69
X0023:Relb UTSW 7 19612667 missense probably benign 0.22
X0066:Relb UTSW 7 19619750 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGATGCCCCATGACCTG -3'
(R):5'- CGCCTTCGCATAGATTAGTGATG -3'

Sequencing Primer
(F):5'- CCATGACCTGGGCTTTCC -3'
(R):5'- CGCATAGATTAGTGATGTTAAGCC -3'
Posted On2015-04-06