Incidental Mutation 'R3878:Slc20a2'
ID276948
Institutional Source Beutler Lab
Gene Symbol Slc20a2
Ensembl Gene ENSMUSG00000037656
Gene Namesolute carrier family 20, member 2
SynonymsPiT-2, MolPit2, Ram-1, Ram1, Pit-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22476788-22569612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22568383 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 645 (L645P)
Ref Sequence ENSEMBL: ENSMUSP00000065935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067786]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067786
AA Change: L645P

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065935
Gene: ENSMUSG00000037656
AA Change: L645P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:PHO4 24 638 1.6e-160 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inorganic phosphate transporter family. The encoded protein is a type 3 sodium-dependent phosphate symporter that plays an important role in phosphate homeostasis by mediating cellular phosphate uptake. The encoded protein also confers susceptibility to viral infection as a gamma-retroviral receptor. Mutations in this gene may play a role in familial idiopathic basal ganglia calcification. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit brain calcifications in the thalamus, basal ganglia and cerebral cortex, microgliosis, and a high inorganic phosphate concentration [Pi] in cerebrospinal fluid. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Slc20a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01474:Slc20a2 APN 8 22535557 missense possibly damaging 0.66
IGL03248:Slc20a2 APN 8 22558983 missense probably benign 0.05
R0015:Slc20a2 UTSW 8 22535345 missense probably damaging 1.00
R0015:Slc20a2 UTSW 8 22535345 missense probably damaging 1.00
R0385:Slc20a2 UTSW 8 22568393 missense probably benign 0.10
R1679:Slc20a2 UTSW 8 22538830 missense possibly damaging 0.87
R1737:Slc20a2 UTSW 8 22545566 missense probably damaging 1.00
R1966:Slc20a2 UTSW 8 22545537 missense probably damaging 1.00
R2217:Slc20a2 UTSW 8 22560516 missense probably benign 0.12
R3821:Slc20a2 UTSW 8 22538902 missense probably benign
R4284:Slc20a2 UTSW 8 22561349 missense probably benign
R4285:Slc20a2 UTSW 8 22561349 missense probably benign
R4915:Slc20a2 UTSW 8 22561004 missense probably damaging 1.00
R4916:Slc20a2 UTSW 8 22561004 missense probably damaging 1.00
R4918:Slc20a2 UTSW 8 22561004 missense probably damaging 1.00
R4938:Slc20a2 UTSW 8 22561205 missense possibly damaging 0.69
R6374:Slc20a2 UTSW 8 22565652 missense possibly damaging 0.94
R6894:Slc20a2 UTSW 8 22560593 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- AAAGTCGGTGTTTGTGAAAGTC -3'
(R):5'- TCTGGAAGATGAGCTGTGGC -3'

Sequencing Primer
(F):5'- GCGTCGTCCTTTAAAGTAGACC -3'
(R):5'- CTGTGGCCTGGGTAAGCAG -3'
Posted On2015-04-06