Incidental Mutation 'R3878:Frs2'
ID276951
Institutional Source Beutler Lab
Gene Symbol Frs2
Ensembl Gene ENSMUSG00000020170
Gene Namefibroblast growth factor receptor substrate 2
SynonymsSNT1, Frs2alpha, C330018A15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location117069427-117148534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 117078910 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 35 (S35A)
Ref Sequence ENSEMBL: ENSMUSP00000020381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020381]
Predicted Effect probably benign
Transcript: ENSMUST00000020381
AA Change: S35A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000020381
Gene: ENSMUSG00000020170
AA Change: S35A

DomainStartEndE-ValueType
IRS 17 110 2.04e-34 SMART
PTBI 18 110 5.71e-35 SMART
low complexity region 130 139 N/A INTRINSIC
low complexity region 450 468 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219483
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit embryonic lethality between E5.75 and E8 and defects in primitive streak formation and anterior-posterior axis formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Frs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Frs2 APN 10 117074886 splice site probably benign
IGL02300:Frs2 APN 10 117077591 missense possibly damaging 0.67
IGL03028:Frs2 APN 10 117073933 missense possibly damaging 0.66
R0001:Frs2 UTSW 10 117074876 missense possibly damaging 0.76
R0513:Frs2 UTSW 10 117074665 missense possibly damaging 0.86
R0708:Frs2 UTSW 10 117074092 missense probably damaging 0.99
R0735:Frs2 UTSW 10 117074582 missense probably damaging 1.00
R1296:Frs2 UTSW 10 117081074 missense probably benign 0.30
R1934:Frs2 UTSW 10 117078901 missense probably damaging 0.99
R1938:Frs2 UTSW 10 117081106 start gained probably benign
R1992:Frs2 UTSW 10 117074554 missense probably benign
R2095:Frs2 UTSW 10 117074602 missense probably benign 0.00
R4732:Frs2 UTSW 10 117074093 missense probably benign 0.31
R4733:Frs2 UTSW 10 117074093 missense probably benign 0.31
R5186:Frs2 UTSW 10 117078842 missense probably damaging 1.00
R5326:Frs2 UTSW 10 117077563 missense probably benign 0.00
R5894:Frs2 UTSW 10 117081106 start gained probably benign
R6084:Frs2 UTSW 10 117076809 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAAGGCTCTCCCTACCTTG -3'
(R):5'- ACAATCAAACCGTCTGACTTGG -3'

Sequencing Primer
(F):5'- GTCCAGTCTGACACCTTCGAC -3'
(R):5'- AATCAAACCGTCTGACTTGGTGTTTG -3'
Posted On2015-04-06