Incidental Mutation 'R3878:Nsa2'
ID276957
Institutional Source Beutler Lab
Gene Symbol Nsa2
Ensembl Gene ENSMUSG00000060739
Gene NameNSA2 ribosome biogenesis homolog
Synonyms5730427N09Rik, LNR42, Nsa2p, Yr29
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location97129424-97137937 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 97132034 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Alanine at position 175 (G175A)
Ref Sequence ENSEMBL: ENSMUSP00000073161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042517] [ENSMUST00000073456] [ENSMUST00000169863] [ENSMUST00000225410]
Predicted Effect probably benign
Transcript: ENSMUST00000042517
SMART Domains Protein: ENSMUSP00000043738
Gene: ENSMUSG00000041817

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073456
AA Change: G175A

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073161
Gene: ENSMUSG00000060739
AA Change: G175A

DomainStartEndE-ValueType
Pfam:Ribosomal_S8e 1 259 1.3e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169863
SMART Domains Protein: ENSMUSP00000126209
Gene: ENSMUSG00000041817

DomainStartEndE-ValueType
low complexity region 374 386 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 650 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224980
Predicted Effect probably benign
Transcript: ENSMUST00000225410
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein involved in cell cycle regulation and proliferation. This gene was identified based on sequence similarity to a highly conserved Saccharomyces cerevisiae gene encoding a pre-ribosomal protein, which is involved in large ribosomal subunit biogenesis. The encoded protein is found at elevated levels in diabetic nephropathy. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Nsa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Nsa2 APN 13 97132017 missense probably damaging 1.00
R3783:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3784:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3786:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
R3787:Nsa2 UTSW 13 97135534 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TTGTGTCACAAGGCCCAGC -3'
(R):5'- CCACTAGTGAGCTATGGCCG -3'

Sequencing Primer
(F):5'- GCTCGCTCACATTCACTTCAATAAC -3'
(R):5'- CAAGCGTTGACATAATGGTCGTAC -3'
Posted On2015-04-06