Mutagenetix > Incidental Mutations

Incidental Mutation 'R3878:Wapl'

276958

Institutional Source

Beutler Lab

Gene Symbol

Wapl

Ensembl Gene

ENSMUSG00000041408

Gene Name

WAPL cohesin release factor

Synonyms

A530089A20Rik, Wapal

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3878 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34673928-34747983 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34692147 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 322 (L322P)

Ref Sequence

ENSEMBL: ENSMUSP00000087481 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048263] [ENSMUST00000090027] [ENSMUST00000169910]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048263
AA Change: L322P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040232
Gene: ENSMUSG00000041408
AA Change: L322P

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	645	1009	6.5e-153	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000090027
AA Change: L322P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087481
Gene: ENSMUSG00000041408
AA Change: L322P

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	639	1003	2.6e-153	PFAM
low complexity region	1012	1027	N/A	INTRINSIC
low complexity region	1095	1106	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000111895

Predicted Effect

probably damaging
Transcript: ENSMUST00000169910
AA Change: L322P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000130547
Gene: ENSMUSG00000041408
AA Change: L322P

Domain	Start	End	E-Value	Type
low complexity region	436	455	N/A	INTRINSIC
low complexity region	465	477	N/A	INTRINSIC
low complexity region	493	513	N/A	INTRINSIC
Pfam:WAPL	647	1008	3.5e-120	PFAM
low complexity region	1018	1033	N/A	INTRINSIC
low complexity region	1101	1112	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: Studies suggest that the protein encoded by this gene is important for the release of cohesin from chromatin. This gene product is thought to be essential for development, and reduced expression of this gene in cells causes defects in chromatin structure. High levels of expression of the human ortholog of this gene are observed in cervical cancers, and expression of the human ortholog of this gene in mice results in tumor formation. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014]
PHENOTYPE: Mice homozygous for a targeted allele exhibit prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020A23Rik	C	T	2: 130,405,640	T32M	probably benign	Het
4930402H24Rik	T	C	2: 130,778,503	R237G	possibly damaging	Het
A2ml1	T	C	6: 128,554,361	S915G	probably benign	Het
Ablim1	T	C	19: 57,037,210		probably null	Het
Cadm2	C	T	16: 66,815,441	E78K	probably damaging	Het
Ceacam5	C	T	7: 17,750,581	P416L	probably damaging	Het
Chsy3	T	C	18: 59,409,773	F661S	probably damaging	Het
Clstn3	G	A	6: 124,457,942	T338I	probably damaging	Het
Ctif	A	G	18: 75,519,977	I403T	probably damaging	Het
Eprs	T	A	1: 185,415,953		probably null	Het
Fam214b	T	G	4: 43,035,867	H288P	probably damaging	Het
Frs2	A	C	10: 117,078,910	S35A	probably benign	Het
Gpr155	C	T	2: 73,368,392	W394*	probably null	Het
Ift140	G	A	17: 25,028,944	V259M	probably benign	Het
Igkv9-124	A	T	6: 67,942,207	S74T	probably benign	Het
Krt14	C	T	11: 100,207,089	V123M	possibly damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Nebl	T	C	2: 17,393,252	T457A	possibly damaging	Het
Nlrp4g	A	G	9: 124,349,362		noncoding transcript	Het
Nsa2	C	G	13: 97,132,034	G175A	probably benign	Het
Olfr1090	T	C	2: 86,754,628	T37A	probably benign	Het
Pax1	A	T	2: 147,362,308		probably benign	Het
Pdzd2	T	C	15: 12,376,176	E1291G	probably benign	Het
Relb	G	A	7: 19,617,844	H115Y	probably damaging	Het
Rnase10	A	G	14: 51,009,432	E52G	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc14a2	C	T	18: 78,159,074	V614I	probably benign	Het
Slc20a2	T	C	8: 22,568,383	L645P	possibly damaging	Het
Smoc2	A	G	17: 14,325,617	D56G	probably damaging	Het
Szt2	A	G	4: 118,390,585	S789P	probably damaging	Het
Tenm2	A	G	11: 36,139,574		probably null	Het
Tm9sf3	A	G	19: 41,246,713	V169A	probably damaging	Het
Trbv13-1	C	T	6: 41,116,388	T86I	probably benign	Het
Trim24	A	G	6: 37,964,773	D886G	probably benign	Het
Trim33	A	G	3: 103,352,005	I1003M	probably damaging	Het
Trim37	T	C	11: 87,206,002	V777A	probably benign	Het
Ttc7	A	C	17: 87,370,738		probably benign	Het
Ttn	T	C	2: 76,766,020	D11856G	possibly damaging	Het
Vmn1r226	A	T	17: 20,687,998	D164V	possibly damaging	Het
Vmn1r34	G	A	6: 66,637,568	T62I	possibly damaging	Het
Zfp62	A	G	11: 49,215,133	D17G	probably damaging	Het

Other mutations in Wapl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00335:Wapl	APN	14	34692636	missense	probably benign	0.00
IGL00539:Wapl	APN	14	34695008	missense	probably damaging	1.00
IGL00846:Wapl	APN	14	34692744	splice site	probably benign
IGL01070:Wapl	APN	14	34745622	unclassified	probably benign
IGL01516:Wapl	APN	14	34692081	missense	probably damaging	1.00
IGL02021:Wapl	APN	14	34722336	missense	probably benign
IGL02209:Wapl	APN	14	34677261	missense	possibly damaging	0.46
IGL02309:Wapl	APN	14	34744863	missense	probably damaging	0.98
IGL02471:Wapl	APN	14	34691920	missense	possibly damaging	0.68
IGL02965:Wapl	APN	14	34739224	intron	probably benign
IGL03076:Wapl	APN	14	34692089	missense	probably benign	0.26
IGL03197:Wapl	APN	14	34745631	missense	possibly damaging	0.77
Mcclintock	UTSW	14	34730662	critical splice donor site	probably null
R0045:Wapl	UTSW	14	34733794	missense	probably benign	0.18
R0278:Wapl	UTSW	14	34692612	missense	possibly damaging	0.68
R0335:Wapl	UTSW	14	34692324	missense	probably damaging	0.99
R1018:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R1295:Wapl	UTSW	14	34724769	missense	probably damaging	1.00
R1553:Wapl	UTSW	14	34729190	missense	probably damaging	1.00
R1868:Wapl	UTSW	14	34692458	missense	probably benign	0.00
R1909:Wapl	UTSW	14	34691912	missense	probably damaging	1.00
R2698:Wapl	UTSW	14	34691777	missense	probably benign
R2990:Wapl	UTSW	14	34736708	missense	probably damaging	0.98
R3121:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3122:Wapl	UTSW	14	34729215	missense	possibly damaging	0.93
R3147:Wapl	UTSW	14	34725149	missense	probably damaging	1.00
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3732:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R3733:Wapl	UTSW	14	34736764	missense	probably damaging	0.99
R4034:Wapl	UTSW	14	34737914	missense	possibly damaging	0.92
R4934:Wapl	UTSW	14	34692095	missense	probably benign	0.11
R5079:Wapl	UTSW	14	34724757	missense	probably damaging	1.00
R5104:Wapl	UTSW	14	34692059	nonsense	probably null
R5113:Wapl	UTSW	14	34724754	missense	probably damaging	1.00
R5121:Wapl	UTSW	14	34677162	missense	probably benign	0.01
R5222:Wapl	UTSW	14	34736685	nonsense	probably null
R5299:Wapl	UTSW	14	34733808	critical splice donor site	probably null
R5387:Wapl	UTSW	14	34677295	missense	probably benign	0.00
R5541:Wapl	UTSW	14	34730662	critical splice donor site	probably null
R5618:Wapl	UTSW	14	34691906	missense	possibly damaging	0.91
R5802:Wapl	UTSW	14	34692320	missense	probably damaging	1.00
R6029:Wapl	UTSW	14	34739247	missense	possibly damaging	0.94
R6292:Wapl	UTSW	14	34729195	missense	probably damaging	1.00
R6482:Wapl	UTSW	14	34692692	missense	probably benign	0.01
R6487:Wapl	UTSW	14	34692292	missense	probably damaging	1.00
R6925:Wapl	UTSW	14	34677363	missense	probably benign	0.31
R6937:Wapl	UTSW	14	34722354	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTCTTTTGGAGATGAAAGACGAG -3'
(R):5'- AATCTGCAGGAGTGGATGC -3'

Sequencing Primer
(F):5'- AGCAACTGTAGGACGTAC -3'
(R):5'- TGGATGCGGTGAACTCATCCATAC -3'

Posted On

2015-04-06