Mutagenetix > Incidental Mutations

Incidental Mutation 'R3878:Cadm2'

276962

Institutional Source

Beutler Lab

Gene Symbol

Cadm2

Ensembl Gene

ENSMUSG00000064115

Gene Name

cell adhesion molecule 2

Synonyms

A830029E02Rik, Necl3, 2900078E11Rik, Igsf4d, SynCAM2

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.352) question?

Stock #

R3878 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

66655421-67620908 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 66815441 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 78 (E78K)

Ref Sequence

ENSEMBL: ENSMUSP00000134554 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000123266] [ENSMUST00000128168]

Predicted Effect

probably damaging
Transcript: ENSMUST00000114292
AA Change: E87K

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: E87K

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IG	38	130	2.19e-9	SMART
Pfam:Ig_3	135	216	1.2e-6	PFAM
Pfam:C2-set_2	135	222	6.4e-17	PFAM
Pfam:Ig_2	135	228	1.8e-6	PFAM
Pfam:I-set	136	229	1.3e-7	PFAM
Pfam:C1-set	142	225	1.5e-9	PFAM
IGc2	248	312	2.56e-10	SMART
4.1m	357	375	5.39e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120594
AA Change: E78K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: E78K

Domain	Start	End	E-Value	Type
IG	29	121	2.19e-9	SMART
Pfam:Ig_3	126	207	4.2e-7	PFAM
Pfam:C2-set_2	126	213	1.8e-16	PFAM
Pfam:I-set	127	220	1.5e-7	PFAM
Pfam:C1-set	133	216	7e-10	PFAM
Pfam:ig	133	218	9.5e-9	PFAM
IGc2	239	303	2.56e-10	SMART
low complexity region	319	352	N/A	INTRINSIC
4.1m	388	406	5.39e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120898
AA Change: E78K

PolyPhen 2 Score 0.815 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: E78K

Domain	Start	End	E-Value	Type
IG	29	121	2.19e-9	SMART
Pfam:Ig_3	126	207	1.2e-6	PFAM
Pfam:C2-set_2	126	213	6.2e-17	PFAM
Pfam:Ig_2	126	219	1.7e-6	PFAM
Pfam:I-set	127	220	1.3e-7	PFAM
Pfam:C1-set	133	216	1.5e-9	PFAM
IGc2	239	303	2.56e-10	SMART
4.1m	348	366	5.39e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123266

SMART Domains

Protein: ENSMUSP00000123192
Gene: ENSMUSG00000064115

Domain	Start	End	E-Value	Type
Blast:IG_like	19	53	1e-15	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000128168
AA Change: E78K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: E78K

Domain	Start	End	E-Value	Type
IG	29	121	2.19e-9	SMART
Pfam:Ig_3	126	207	1.4e-6	PFAM
Pfam:C2-set_2	126	213	7.2e-16	PFAM
Pfam:I-set	127	220	5e-7	PFAM
Pfam:C1-set	133	216	2.2e-9	PFAM
Pfam:ig	133	218	3.6e-8	PFAM
IGc2	239	303	2.56e-10	SMART
low complexity region	319	352	N/A	INTRINSIC
4.1m	388	406	5.39e-5	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141282

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020A23Rik	C	T	2: 130,405,640	T32M	probably benign	Het
4930402H24Rik	T	C	2: 130,778,503	R237G	possibly damaging	Het
A2ml1	T	C	6: 128,554,361	S915G	probably benign	Het
Ablim1	T	C	19: 57,037,210		probably null	Het
Ceacam5	C	T	7: 17,750,581	P416L	probably damaging	Het
Chsy3	T	C	18: 59,409,773	F661S	probably damaging	Het
Clstn3	G	A	6: 124,457,942	T338I	probably damaging	Het
Ctif	A	G	18: 75,519,977	I403T	probably damaging	Het
Eprs	T	A	1: 185,415,953		probably null	Het
Fam214b	T	G	4: 43,035,867	H288P	probably damaging	Het
Frs2	A	C	10: 117,078,910	S35A	probably benign	Het
Gpr155	C	T	2: 73,368,392	W394*	probably null	Het
Ift140	G	A	17: 25,028,944	V259M	probably benign	Het
Igkv9-124	A	T	6: 67,942,207	S74T	probably benign	Het
Krt14	C	T	11: 100,207,089	V123M	possibly damaging	Het
Mcm2	G	A	6: 88,893,008	R60C	probably damaging	Het
Nebl	T	C	2: 17,393,252	T457A	possibly damaging	Het
Nlrp4g	A	G	9: 124,349,362		noncoding transcript	Het
Nsa2	C	G	13: 97,132,034	G175A	probably benign	Het
Olfr1090	T	C	2: 86,754,628	T37A	probably benign	Het
Pax1	A	T	2: 147,362,308		probably benign	Het
Pdzd2	T	C	15: 12,376,176	E1291G	probably benign	Het
Relb	G	A	7: 19,617,844	H115Y	probably damaging	Het
Rnase10	A	G	14: 51,009,432	E52G	probably damaging	Het
Sla2	G	A	2: 156,875,942	R137C	probably damaging	Het
Slc14a2	C	T	18: 78,159,074	V614I	probably benign	Het
Slc20a2	T	C	8: 22,568,383	L645P	possibly damaging	Het
Smoc2	A	G	17: 14,325,617	D56G	probably damaging	Het
Szt2	A	G	4: 118,390,585	S789P	probably damaging	Het
Tenm2	A	G	11: 36,139,574		probably null	Het
Tm9sf3	A	G	19: 41,246,713	V169A	probably damaging	Het
Trbv13-1	C	T	6: 41,116,388	T86I	probably benign	Het
Trim24	A	G	6: 37,964,773	D886G	probably benign	Het
Trim33	A	G	3: 103,352,005	I1003M	probably damaging	Het
Trim37	T	C	11: 87,206,002	V777A	probably benign	Het
Ttc7	A	C	17: 87,370,738		probably benign	Het
Ttn	T	C	2: 76,766,020	D11856G	possibly damaging	Het
Vmn1r226	A	T	17: 20,687,998	D164V	possibly damaging	Het
Vmn1r34	G	A	6: 66,637,568	T62I	possibly damaging	Het
Wapl	T	C	14: 34,692,147	L322P	probably damaging	Het
Zfp62	A	G	11: 49,215,133	D17G	probably damaging	Het

Other mutations in Cadm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cadm2	APN	16	66882751	missense	probably damaging	1.00
IGL01137:Cadm2	APN	16	66815350	missense	probably damaging	1.00
IGL01340:Cadm2	APN	16	66784785	missense	possibly damaging	0.62
IGL01406:Cadm2	APN	16	66815304	splice site	probably null
IGL02029:Cadm2	APN	16	66747296	missense	probably damaging	1.00
IGL02541:Cadm2	APN	16	66882882	missense	possibly damaging	0.73
IGL02541:Cadm2	APN	16	66882883	critical splice acceptor site	probably null
IGL02952:Cadm2	APN	16	66664452	missense	probably damaging	0.99
R0050:Cadm2	UTSW	16	66953266	splice site	probably benign
R0050:Cadm2	UTSW	16	66953266	splice site	probably benign
R0399:Cadm2	UTSW	16	66747339	nonsense	probably null
R0883:Cadm2	UTSW	16	66882814	missense	probably damaging	1.00
R1035:Cadm2	UTSW	16	66815347	missense	probably damaging	1.00
R1539:Cadm2	UTSW	16	66784840	missense	probably damaging	1.00
R1889:Cadm2	UTSW	16	66882795	missense	probably damaging	1.00
R1898:Cadm2	UTSW	16	66815383	missense	probably damaging	1.00
R1918:Cadm2	UTSW	16	66747384	splice site	probably benign
R2108:Cadm2	UTSW	16	66731471	missense	probably benign	0.43
R2570:Cadm2	UTSW	16	66815383	missense	probably damaging	1.00
R4093:Cadm2	UTSW	16	66784788	missense	possibly damaging	0.94
R4094:Cadm2	UTSW	16	66882797	missense	probably damaging	1.00
R5421:Cadm2	UTSW	16	66771627	nonsense	probably null
R5555:Cadm2	UTSW	16	66784815	missense	probably damaging	1.00
R6173:Cadm2	UTSW	16	66882841	missense	probably benign	0.04
R6188:Cadm2	UTSW	16	66815307	critical splice donor site	probably null
R6224:Cadm2	UTSW	16	66664395	missense	probably damaging	1.00
R6492:Cadm2	UTSW	16	66784828	missense	probably damaging	0.98
R6957:Cadm2	UTSW	16	66812838	missense	probably benign	0.02
X0026:Cadm2	UTSW	16	66663152	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCTGATTGAAACATGCTGTAGC -3'
(R):5'- CCATCAATCTCTTCCTCACTGAAAG -3'

Sequencing Primer
(F):5'- AGCAGGGCACATTTTTCTGAGAG -3'
(R):5'- ACTGTATTCCAGGTTGCA -3'

Posted On

2015-04-06