Incidental Mutation 'R3878:Smoc2'
ID276963
Institutional Source Beutler Lab
Gene Symbol Smoc2
Ensembl Gene ENSMUSG00000023886
Gene NameSPARC related modular calcium binding 2
SynonymsSmoc2l, 5430426J21Rik, 1700056C05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location14279506-14404790 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14325617 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 56 (D56G)
Ref Sequence ENSEMBL: ENSMUSP00000024660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024660]
Predicted Effect probably damaging
Transcript: ENSMUST00000024660
AA Change: D56G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024660
Gene: ENSMUSG00000023886
AA Change: D56G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
KAZAL 39 84 1.49e-12 SMART
TY 110 157 3.07e-14 SMART
low complexity region 166 177 N/A INTRINSIC
TY 237 285 3.34e-15 SMART
Pfam:SPARC_Ca_bdg 302 412 8.6e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SPARC family (secreted protein acidic and rich in cysteine/osteonectin/BM-40), which are highly expressed during embryogenesis and wound healing. The gene product is a matricellular protein which promotes matrix assembly and can stimulate endothelial cell proliferation and migration, as well as angiogenic activity. Associated with pulmonary function, this secretory gene product contains a Kazal domain, two thymoglobulin type-1 domains, and two EF-hand calcium-binding domains. The encoded protein may serve as a target for controlling angiogenesis in tumor growth and myocardial ischemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for one KO allele exhibit protection from induced kidney fibrosis and reduced interstitial myofibroblast accumulation. Another KO allele leads to shortening and widening of the skull. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Smoc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Smoc2 APN 17 14325614 missense probably damaging 1.00
IGL02085:Smoc2 APN 17 14347233 missense possibly damaging 0.79
IGL02309:Smoc2 APN 17 14375527 splice site probably benign
IGL02975:Smoc2 APN 17 14336610 missense probably damaging 0.98
FR4976:Smoc2 UTSW 17 14401562 small deletion probably benign
R2291:Smoc2 UTSW 17 14368971 missense possibly damaging 0.53
R2343:Smoc2 UTSW 17 14344342 missense probably benign 0.22
R2888:Smoc2 UTSW 17 14397625 critical splice donor site probably null
R4872:Smoc2 UTSW 17 14369033 missense probably benign 0.12
R5153:Smoc2 UTSW 17 14336579 missense probably damaging 1.00
R5175:Smoc2 UTSW 17 14375457 missense possibly damaging 0.89
R5239:Smoc2 UTSW 17 14368965 missense probably benign 0.19
R5292:Smoc2 UTSW 17 14336573 missense probably damaging 0.98
R5794:Smoc2 UTSW 17 14369048 missense possibly damaging 0.94
X0026:Smoc2 UTSW 17 14336633 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGCAATTCACTCGATGTTTCAG -3'
(R):5'- GAAGCTTTCAAGTTGTTGAGCATG -3'

Sequencing Primer
(F):5'- GTGAGCACCGAGTAGCCATATTTC -3'
(R):5'- TTTGCAATTCCCACGGTG -3'
Posted On2015-04-06