Incidental Mutation 'R3878:Slc14a2'
ID276968
Institutional Source Beutler Lab
Gene Symbol Slc14a2
Ensembl Gene ENSMUSG00000024552
Gene Namesolute carrier family 14 (urea transporter), member 2
SynonymsUT-A5, UT-A3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location78146940-78209094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78159074 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 614 (V614I)
Ref Sequence ENSEMBL: ENSMUSP00000025434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025434]
Predicted Effect probably benign
Transcript: ENSMUST00000025434
AA Change: V614I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: V614I

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 31 43 N/A INTRINSIC
low complexity region 82 97 N/A INTRINSIC
Pfam:UT 128 423 1.9e-105 PFAM
low complexity region 460 471 N/A INTRINSIC
Pfam:UT 591 886 7.5e-112 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Tm9sf3 A G 19: 41,246,713 V169A probably damaging Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Slc14a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Slc14a2 APN 18 78150438 missense possibly damaging 0.65
IGL00763:Slc14a2 APN 18 78192238 missense probably damaging 1.00
IGL01359:Slc14a2 APN 18 78154108 missense probably benign 0.01
IGL01400:Slc14a2 APN 18 78192213 missense probably damaging 1.00
IGL01450:Slc14a2 APN 18 78183530 missense probably damaging 0.97
IGL01469:Slc14a2 APN 18 78155566 missense probably damaging 0.98
IGL02231:Slc14a2 APN 18 78209021 missense possibly damaging 0.92
IGL02340:Slc14a2 APN 18 78163126 missense probably damaging 1.00
IGL02542:Slc14a2 APN 18 78209087 missense probably benign
xi_ning UTSW 18 78195747 missense probably benign 0.01
IGL02991:Slc14a2 UTSW 18 78205834 start codon destroyed probably null 0.77
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0131:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0132:Slc14a2 UTSW 18 78192123 missense probably damaging 1.00
R0601:Slc14a2 UTSW 18 78157179 nonsense probably null
R1677:Slc14a2 UTSW 18 78163204 missense probably benign
R1749:Slc14a2 UTSW 18 78147080 missense possibly damaging 0.67
R2014:Slc14a2 UTSW 18 78150386 splice site probably benign
R2034:Slc14a2 UTSW 18 78183583 missense probably damaging 0.99
R2264:Slc14a2 UTSW 18 78163089 splice site probably benign
R2278:Slc14a2 UTSW 18 78159944 missense probably benign 0.01
R2920:Slc14a2 UTSW 18 78158297 nonsense probably null
R4086:Slc14a2 UTSW 18 78205783 missense probably damaging 1.00
R4237:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4238:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4239:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4300:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4373:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4375:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4376:Slc14a2 UTSW 18 78207068 missense probably damaging 1.00
R4440:Slc14a2 UTSW 18 78195747 missense probably benign 0.01
R4551:Slc14a2 UTSW 18 78195853 missense probably benign 0.02
R4636:Slc14a2 UTSW 18 78195792 missense possibly damaging 0.88
R4749:Slc14a2 UTSW 18 78155581 missense probably damaging 1.00
R4921:Slc14a2 UTSW 18 78192188 missense probably damaging 0.97
R4983:Slc14a2 UTSW 18 78150401 missense probably damaging 0.98
R5114:Slc14a2 UTSW 18 78195748 missense possibly damaging 0.62
R5164:Slc14a2 UTSW 18 78157272 missense probably damaging 1.00
R5386:Slc14a2 UTSW 18 78185840 missense possibly damaging 0.65
R5433:Slc14a2 UTSW 18 78208928 missense probably damaging 1.00
R5558:Slc14a2 UTSW 18 78159166 missense possibly damaging 0.94
R5571:Slc14a2 UTSW 18 78209067 missense possibly damaging 0.73
R5693:Slc14a2 UTSW 18 78147014 missense probably benign 0.23
R5715:Slc14a2 UTSW 18 78158336 missense probably damaging 1.00
R5719:Slc14a2 UTSW 18 78209042 missense probably benign 0.06
R6160:Slc14a2 UTSW 18 78158975 critical splice donor site probably null
R6352:Slc14a2 UTSW 18 78209094 start codon destroyed probably null
R6380:Slc14a2 UTSW 18 78146975 missense probably benign 0.00
R6444:Slc14a2 UTSW 18 78154102 missense probably damaging 0.98
R6480:Slc14a2 UTSW 18 78159082 missense possibly damaging 0.80
R6732:Slc14a2 UTSW 18 78192174 missense probably damaging 1.00
Z1088:Slc14a2 UTSW 18 78195780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGCACCATTGGTTTGATGAG -3'
(R):5'- ATTTCACACCGATCCCCTGAAG -3'

Sequencing Primer
(F):5'- AGCACCATTGGTTTGATGAGTTTGAG -3'
(R):5'- TGAAGACCCTCACTCCCACTG -3'
Posted On2015-04-06