Incidental Mutation 'R3878:Tm9sf3'
ID276969
Institutional Source Beutler Lab
Gene Symbol Tm9sf3
Ensembl Gene ENSMUSG00000025016
Gene Nametransmembrane 9 superfamily member 3
Synonyms1810073M23Rik, 2810031D16Rik, Smbp
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R3878 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41210842-41264004 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41246713 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 169 (V169A)
Ref Sequence ENSEMBL: ENSMUSP00000025989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025989]
Predicted Effect probably damaging
Transcript: ENSMUST00000025989
AA Change: V169A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025989
Gene: ENSMUSG00000025016
AA Change: V169A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:EMP70 55 544 6.2e-164 PFAM
transmembrane domain 549 571 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020A23Rik C T 2: 130,405,640 T32M probably benign Het
4930402H24Rik T C 2: 130,778,503 R237G possibly damaging Het
A2ml1 T C 6: 128,554,361 S915G probably benign Het
Ablim1 T C 19: 57,037,210 probably null Het
Cadm2 C T 16: 66,815,441 E78K probably damaging Het
Ceacam5 C T 7: 17,750,581 P416L probably damaging Het
Chsy3 T C 18: 59,409,773 F661S probably damaging Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Ctif A G 18: 75,519,977 I403T probably damaging Het
Eprs T A 1: 185,415,953 probably null Het
Fam214b T G 4: 43,035,867 H288P probably damaging Het
Frs2 A C 10: 117,078,910 S35A probably benign Het
Gpr155 C T 2: 73,368,392 W394* probably null Het
Ift140 G A 17: 25,028,944 V259M probably benign Het
Igkv9-124 A T 6: 67,942,207 S74T probably benign Het
Krt14 C T 11: 100,207,089 V123M possibly damaging Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Nebl T C 2: 17,393,252 T457A possibly damaging Het
Nlrp4g A G 9: 124,349,362 noncoding transcript Het
Nsa2 C G 13: 97,132,034 G175A probably benign Het
Olfr1090 T C 2: 86,754,628 T37A probably benign Het
Pax1 A T 2: 147,362,308 probably benign Het
Pdzd2 T C 15: 12,376,176 E1291G probably benign Het
Relb G A 7: 19,617,844 H115Y probably damaging Het
Rnase10 A G 14: 51,009,432 E52G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Slc14a2 C T 18: 78,159,074 V614I probably benign Het
Slc20a2 T C 8: 22,568,383 L645P possibly damaging Het
Smoc2 A G 17: 14,325,617 D56G probably damaging Het
Szt2 A G 4: 118,390,585 S789P probably damaging Het
Tenm2 A G 11: 36,139,574 probably null Het
Trbv13-1 C T 6: 41,116,388 T86I probably benign Het
Trim24 A G 6: 37,964,773 D886G probably benign Het
Trim33 A G 3: 103,352,005 I1003M probably damaging Het
Trim37 T C 11: 87,206,002 V777A probably benign Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ttn T C 2: 76,766,020 D11856G possibly damaging Het
Vmn1r226 A T 17: 20,687,998 D164V possibly damaging Het
Vmn1r34 G A 6: 66,637,568 T62I possibly damaging Het
Wapl T C 14: 34,692,147 L322P probably damaging Het
Zfp62 A G 11: 49,215,133 D17G probably damaging Het
Other mutations in Tm9sf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01395:Tm9sf3 APN 19 41256276 missense probably damaging 1.00
IGL02176:Tm9sf3 APN 19 41246637 splice site probably benign
R0504:Tm9sf3 UTSW 19 41247892 splice site probably benign
R0564:Tm9sf3 UTSW 19 41245525 splice site probably benign
R0586:Tm9sf3 UTSW 19 41256143 critical splice donor site probably null
R1224:Tm9sf3 UTSW 19 41223195 missense probably damaging 1.00
R1533:Tm9sf3 UTSW 19 41238784 missense probably benign 0.00
R1646:Tm9sf3 UTSW 19 41223179 missense possibly damaging 0.79
R1748:Tm9sf3 UTSW 19 41256229 missense probably benign 0.01
R2022:Tm9sf3 UTSW 19 41238792 missense probably damaging 1.00
R2172:Tm9sf3 UTSW 19 41217420 missense probably damaging 1.00
R3844:Tm9sf3 UTSW 19 41217116 missense possibly damaging 0.95
R4384:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4385:Tm9sf3 UTSW 19 41247933 missense probably damaging 1.00
R4582:Tm9sf3 UTSW 19 41256166 missense probably damaging 1.00
R5497:Tm9sf3 UTSW 19 41215116 missense probably benign 0.03
R5876:Tm9sf3 UTSW 19 41240584 missense probably damaging 1.00
R6305:Tm9sf3 UTSW 19 41245442 critical splice donor site probably null
R6924:Tm9sf3 UTSW 19 41218278 missense probably damaging 1.00
R6936:Tm9sf3 UTSW 19 41223199 missense probably benign 0.44
X0026:Tm9sf3 UTSW 19 41246762 missense possibly damaging 0.91
X0026:Tm9sf3 UTSW 19 41246763 nonsense probably null
Z1088:Tm9sf3 UTSW 19 41232378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACACTGAGGAATTTTGTTGCATC -3'
(R):5'- TGCTTGCTAAGAAGGCCAG -3'

Sequencing Primer
(F):5'- AACACAACCATTTCTTCCTCTA -3'
(R):5'- CATGAAGATAATGGTAGAGTTGCCTC -3'
Posted On2015-04-06