Incidental Mutation 'R3839:Gcnt4'
ID277070
Institutional Source Beutler Lab
Gene Symbol Gcnt4
Ensembl Gene ENSMUSG00000091387
Gene Nameglucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)
SynonymsLOC218476, LOC238786, Gm73, C2GNT3
MMRRC Submission 040892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3839 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location96924689-96950906 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 96947014 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 273 (R273*)
Ref Sequence ENSEMBL: ENSMUSP00000130496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171324]
Predicted Effect probably null
Transcript: ENSMUST00000171324
AA Change: R273*
SMART Domains Protein: ENSMUSP00000130496
Gene: ENSMUSG00000091387
AA Change: R273*

DomainStartEndE-ValueType
transmembrane domain 17 39 N/A INTRINSIC
Pfam:Branch 134 403 1.1e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222094
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (48/49)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display neutrophilia, increased aggression towards males, reduced serum thyroxine levels, and altered O-glycan structures in the stomach, colon, and small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Abraxas2 T A 7: 132,883,138 S303R probably benign Het
Ackr3 G A 1: 90,214,128 S103N probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cald1 A T 6: 34,745,765 D122V probably damaging Het
Cc2d2a T C 5: 43,718,714 V1011A probably benign Het
Cdh9 G T 15: 16,823,438 E169* probably null Het
Cmbl T C 15: 31,581,998 V47A probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctnnd2 T A 15: 31,009,028 probably null Het
Cyp4a10 A C 4: 115,525,347 E278A possibly damaging Het
Ddx56 T C 11: 6,267,712 D3G probably benign Het
Dnajb2 G A 1: 75,241,480 probably null Het
Eif3d T A 15: 77,964,100 T211S probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Garnl3 C T 2: 32,989,546 G923S probably benign Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gpr156 T A 16: 37,988,600 V228D probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itga3 A G 11: 95,057,269 probably null Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Klhl40 A G 9: 121,780,416 Y453C possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Rala A T 13: 17,893,174 C91S probably damaging Het
Rps9 A G 7: 3,706,824 probably benign Het
Sdr16c5 C A 4: 4,006,601 M230I probably damaging Het
Sec14l3 A G 11: 4,071,544 probably null Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Skor1 A C 9: 63,144,448 S746R probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc47a1 G T 11: 61,353,058 probably benign Het
Slit3 A T 11: 35,508,237 N143I probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r109 A G 17: 20,554,442 V217A probably damaging Het
Zfp108 A G 7: 24,260,556 I191V probably benign Het
Other mutations in Gcnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Gcnt4 APN 13 96946556 missense probably damaging 1.00
IGL02677:Gcnt4 APN 13 96947233 missense probably benign
IGL02936:Gcnt4 APN 13 96946411 missense probably benign 0.00
R0332:Gcnt4 UTSW 13 96946510 missense probably benign 0.01
R0741:Gcnt4 UTSW 13 96946432 nonsense probably null
R0853:Gcnt4 UTSW 13 96946835 missense probably damaging 1.00
R2156:Gcnt4 UTSW 13 96946466 missense probably damaging 0.99
R3837:Gcnt4 UTSW 13 96947014 nonsense probably null
R3838:Gcnt4 UTSW 13 96947014 nonsense probably null
R4434:Gcnt4 UTSW 13 96946342 missense probably benign 0.00
R4611:Gcnt4 UTSW 13 96946482 missense probably benign
R4782:Gcnt4 UTSW 13 96947406 missense possibly damaging 0.88
R5853:Gcnt4 UTSW 13 96946652 missense probably benign 0.01
R6013:Gcnt4 UTSW 13 96947278 missense possibly damaging 0.95
R6139:Gcnt4 UTSW 13 96946852 missense probably benign 0.16
R6329:Gcnt4 UTSW 13 96947273 missense probably damaging 1.00
R7131:Gcnt4 UTSW 13 96946519 missense probably damaging 0.98
R7217:Gcnt4 UTSW 13 96946310 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGTCTTCCGTTCAGTGG -3'
(R):5'- TCCTGGTATCCGGATTAAGGTG -3'

Sequencing Primer
(F):5'- GAAGTACGTCATCAACCTCTGTGG -3'
(R):5'- TTAAGGTGGCCCAAAAGTGCTC -3'
Posted On2015-04-06