Incidental Mutation 'R3839:Cdh9'
ID277072
Institutional Source Beutler Lab
Gene Symbol Cdh9
Ensembl Gene ENSMUSG00000025370
Gene Namecadherin 9
SynonymsT1-cadherin
MMRRC Submission 040892-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R3839 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location16728756-16857094 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 16823438 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 169 (E169*)
Ref Sequence ENSEMBL: ENSMUSP00000154022 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026432] [ENSMUST00000228307]
Predicted Effect probably null
Transcript: ENSMUST00000026432
AA Change: E169*
SMART Domains Protein: ENSMUSP00000026432
Gene: ENSMUSG00000025370
AA Change: E169*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 75 156 2.84e-15 SMART
CA 180 265 5.63e-28 SMART
CA 289 381 1.12e-13 SMART
CA 404 485 8.03e-24 SMART
CA 508 595 1.34e-2 SMART
transmembrane domain 613 635 N/A INTRINSIC
Pfam:Cadherin_C 638 782 1.5e-54 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000228307
AA Change: E169*
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.8%
  • 20x: 96.4%
Validation Efficiency 98% (48/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type II classical cadherin from the cadherin superfamily, integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Mature cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous knockout results in the formation of abnormal axonal arbors in some retinal type 5 bipolar cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,812,385 noncoding transcript Het
Abraxas2 T A 7: 132,883,138 S303R probably benign Het
Ackr3 G A 1: 90,214,128 S103N probably damaging Het
Arhgef25 T C 10: 127,189,736 T12A probably benign Het
Aspm C T 1: 139,478,054 H1560Y probably benign Het
Atg10 A T 13: 90,937,380 I150K probably damaging Het
AW551984 T C 9: 39,597,908 probably benign Het
Cald1 A T 6: 34,745,765 D122V probably damaging Het
Cc2d2a T C 5: 43,718,714 V1011A probably benign Het
Cmbl T C 15: 31,581,998 V47A probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Ctnnd2 T A 15: 31,009,028 probably null Het
Cyp4a10 A C 4: 115,525,347 E278A possibly damaging Het
Ddx56 T C 11: 6,267,712 D3G probably benign Het
Dnajb2 G A 1: 75,241,480 probably null Het
Eif3d T A 15: 77,964,100 T211S probably benign Het
Fam13c C T 10: 70,542,648 S336L probably damaging Het
Garnl3 C T 2: 32,989,546 G923S probably benign Het
Gcnt4 A T 13: 96,947,014 R273* probably null Het
Gldc T A 19: 30,118,675 probably benign Het
Glra2 C T X: 165,289,616 V85I probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gpam T C 19: 55,080,458 N450S probably benign Het
Gpr156 T A 16: 37,988,600 V228D probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmgcr A G 13: 96,659,089 I324T probably benign Het
Itga3 A G 11: 95,057,269 probably null Het
Itih1 T A 14: 30,935,828 N429Y probably damaging Het
Klhl40 A G 9: 121,780,416 Y453C possibly damaging Het
Mid1ip1 T C X: 10,718,381 V51A possibly damaging Het
Msn C A X: 96,160,199 Q303K probably damaging Het
Nap1l1 T A 10: 111,495,322 probably null Het
Rala A T 13: 17,893,174 C91S probably damaging Het
Rps9 A G 7: 3,706,824 probably benign Het
Sdr16c5 C A 4: 4,006,601 M230I probably damaging Het
Sec14l3 A G 11: 4,071,544 probably null Het
Senp2 T C 16: 22,009,735 S32P probably damaging Het
Skor1 A C 9: 63,144,448 S746R probably damaging Het
Slc17a4 C T 13: 23,901,769 R387H probably benign Het
Slc47a1 G T 11: 61,353,058 probably benign Het
Slit3 A T 11: 35,508,237 N143I probably benign Het
Tpbg T C 9: 85,843,114 probably benign Het
Tubb2a G T 13: 34,075,311 N165K probably benign Het
Usp14 A G 18: 10,024,532 probably null Het
Vmn2r109 A G 17: 20,554,442 V217A probably damaging Het
Zfp108 A G 7: 24,260,556 I191V probably benign Het
Other mutations in Cdh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cdh9 APN 15 16828362 missense probably damaging 1.00
IGL00555:Cdh9 APN 15 16823406 missense probably damaging 1.00
IGL01110:Cdh9 APN 15 16855926 missense possibly damaging 0.63
IGL01432:Cdh9 APN 15 16830947 missense probably damaging 1.00
IGL01768:Cdh9 APN 15 16778225 missense possibly damaging 0.51
IGL02043:Cdh9 APN 15 16856232 missense probably damaging 1.00
IGL02304:Cdh9 APN 15 16848601 missense probably benign 0.01
IGL02380:Cdh9 APN 15 16856000 missense possibly damaging 0.79
IGL02505:Cdh9 APN 15 16855989 missense probably damaging 1.00
IGL02675:Cdh9 APN 15 16849076 splice site probably null
IGL02679:Cdh9 APN 15 16832230 missense probably damaging 0.97
IGL03288:Cdh9 APN 15 16856049 missense probably damaging 1.00
R0426:Cdh9 UTSW 15 16823454 critical splice donor site probably null
R0726:Cdh9 UTSW 15 16831044 missense probably benign 0.00
R1335:Cdh9 UTSW 15 16850792 missense probably benign 0.00
R1368:Cdh9 UTSW 15 16848482 splice site probably benign
R1766:Cdh9 UTSW 15 16778306 missense probably damaging 1.00
R1916:Cdh9 UTSW 15 16823275 missense probably benign 0.03
R2325:Cdh9 UTSW 15 16778200 missense probably benign
R2424:Cdh9 UTSW 15 16850354 missense probably damaging 1.00
R3104:Cdh9 UTSW 15 16855814 missense probably damaging 1.00
R3837:Cdh9 UTSW 15 16823438 nonsense probably null
R4241:Cdh9 UTSW 15 16849079 critical splice acceptor site probably null
R4248:Cdh9 UTSW 15 16850388 missense probably benign 0.00
R4576:Cdh9 UTSW 15 16832239 missense possibly damaging 0.73
R4679:Cdh9 UTSW 15 16850959 missense probably benign
R4896:Cdh9 UTSW 15 16778156 missense probably benign 0.12
R4961:Cdh9 UTSW 15 16850828 missense probably benign
R5050:Cdh9 UTSW 15 16778147 missense probably benign 0.12
R5089:Cdh9 UTSW 15 16778276 missense probably damaging 1.00
R5268:Cdh9 UTSW 15 16851013 missense probably benign
R5567:Cdh9 UTSW 15 16855844 missense probably damaging 1.00
R5646:Cdh9 UTSW 15 16823285 missense probably damaging 1.00
R5894:Cdh9 UTSW 15 16832100 missense possibly damaging 0.47
R6440:Cdh9 UTSW 15 16823423 missense probably benign 0.01
R6441:Cdh9 UTSW 15 16823423 missense probably benign 0.01
X0062:Cdh9 UTSW 15 16848539 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACGCTGCAAAGAGACTAGAC -3'
(R):5'- CTGCCATTGGAATCAAACAACTTC -3'

Sequencing Primer
(F):5'- GAGACTAGACAGAGAAGAAAAATCTC -3'
(R):5'- CTGAGAGGGCATATGGAATC -3'
Posted On2015-04-06