Incidental Mutation 'R3840:Abcc8'
ID277109
Institutional Source Beutler Lab
Gene Symbol Abcc8
Ensembl Gene ENSMUSG00000040136
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 8
SynonymsD930031B21Rik, SUR1, Sur
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R3840 (G1)
Quality Score212
Status Not validated
Chromosome7
Chromosomal Location46104523-46180033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46108100 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1375 (I1375T)
Ref Sequence ENSEMBL: ENSMUSP00000033123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033123]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033123
AA Change: I1375T

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033123
Gene: ENSMUSG00000040136
AA Change: I1375T

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 73 95 N/A INTRINSIC
transmembrane domain 105 124 N/A INTRINSIC
transmembrane domain 131 148 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 299 590 1.3e-39 PFAM
AAA 705 920 4.46e-14 SMART
low complexity region 972 994 N/A INTRINSIC
Pfam:ABC_membrane 1019 1301 1.3e-49 PFAM
AAA 1377 1570 4.33e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210637
Predicted Effect unknown
Transcript: ENSMUST00000210655
AA Change: I696T
Predicted Effect probably benign
Transcript: ENSMUST00000210770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211039
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. This protein functions as a modulator of ATP-sensitive potassium channels and insulin release. Mutations and deficiencies in this protein have been observed in patients with hyperinsulinemic hypoglycemia of infancy, an autosomal recessive disorder of unregulated and high insulin secretion. Mutations have also been associated with non-insulin-dependent diabetes mellitus type II, an autosomal dominant disease of defective insulin secretion. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a transient neonatal hypoglycemia and a late-developing glucose intolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Jhy T A 9: 40,944,846 E115V probably benign Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Abcc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Abcc8 APN 7 46104664 missense probably benign
IGL01457:Abcc8 APN 7 46135493 missense possibly damaging 0.51
IGL01645:Abcc8 APN 7 46115053 missense possibly damaging 0.93
IGL01683:Abcc8 APN 7 46151667 missense possibly damaging 0.78
IGL01826:Abcc8 APN 7 46124849 missense probably benign 0.01
IGL01912:Abcc8 APN 7 46120510 missense probably damaging 1.00
IGL02218:Abcc8 APN 7 46120436 missense probably benign 0.00
IGL02326:Abcc8 APN 7 46122857 critical splice donor site probably null
IGL02403:Abcc8 APN 7 46105803 splice site probably null
IGL02411:Abcc8 APN 7 46107007 missense probably damaging 1.00
IGL02653:Abcc8 APN 7 46115767
IGL02706:Abcc8 APN 7 46166921 missense probably benign 0.08
R0295:Abcc8 UTSW 7 46118054 missense probably benign
R0381:Abcc8 UTSW 7 46108434 missense possibly damaging 0.46
R0391:Abcc8 UTSW 7 46122173 missense probably damaging 0.98
R0408:Abcc8 UTSW 7 46107033 missense probably damaging 0.99
R0496:Abcc8 UTSW 7 46108820 missense probably damaging 1.00
R1126:Abcc8 UTSW 7 46109638 missense probably damaging 0.99
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1323:Abcc8 UTSW 7 46117362 missense probably benign 0.07
R1352:Abcc8 UTSW 7 46135468 splice site probably benign
R1368:Abcc8 UTSW 7 46122860 missense probably damaging 1.00
R1437:Abcc8 UTSW 7 46179813 missense probably damaging 1.00
R1463:Abcc8 UTSW 7 46154512 missense probably benign 0.12
R1689:Abcc8 UTSW 7 46120403 missense probably benign 0.16
R1717:Abcc8 UTSW 7 46115815 missense possibly damaging 0.91
R1804:Abcc8 UTSW 7 46120479 missense probably benign 0.02
R1848:Abcc8 UTSW 7 46166902 missense probably benign
R1870:Abcc8 UTSW 7 46123915 missense probably benign 0.05
R1938:Abcc8 UTSW 7 46175371 missense possibly damaging 0.49
R1993:Abcc8 UTSW 7 46117423 splice site probably null
R1994:Abcc8 UTSW 7 46157119 missense probably benign 0.02
R2511:Abcc8 UTSW 7 46150780 missense probably damaging 1.00
R3879:Abcc8 UTSW 7 46104627 missense possibly damaging 0.90
R4444:Abcc8 UTSW 7 46136194 missense probably benign 0.09
R4463:Abcc8 UTSW 7 46106581 splice site probably null
R4761:Abcc8 UTSW 7 46113075 missense probably damaging 1.00
R4816:Abcc8 UTSW 7 46104707 missense probably benign 0.01
R4841:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4842:Abcc8 UTSW 7 46150828 missense probably damaging 1.00
R4870:Abcc8 UTSW 7 46107259 nonsense probably null
R4969:Abcc8 UTSW 7 46105519 missense probably benign 0.02
R4975:Abcc8 UTSW 7 46150867 missense probably damaging 0.98
R5258:Abcc8 UTSW 7 46108387 missense probably benign
R5258:Abcc8 UTSW 7 46157148 missense probably benign 0.17
R5502:Abcc8 UTSW 7 46108838 missense probably benign 0.00
R5518:Abcc8 UTSW 7 46120449 missense probably benign
R5660:Abcc8 UTSW 7 46108404 missense probably benign 0.15
R5902:Abcc8 UTSW 7 46115039 missense probably benign
R5907:Abcc8 UTSW 7 46123906 missense probably benign 0.01
R6023:Abcc8 UTSW 7 46108419 missense possibly damaging 0.62
R6026:Abcc8 UTSW 7 46167000 missense probably benign
R6078:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6079:Abcc8 UTSW 7 46105844 missense probably benign 0.01
R6103:Abcc8 UTSW 7 46119021 missense possibly damaging 0.50
R6221:Abcc8 UTSW 7 46175450 missense probably benign 0.01
R6511:Abcc8 UTSW 7 46150861 missense possibly damaging 0.82
U15987:Abcc8 UTSW 7 46105844 missense probably benign 0.01
Z1088:Abcc8 UTSW 7 46138065 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGCAGGTCCAGAGGATATAGC -3'
(R):5'- AACCTGCAGGGCGTTAATC -3'

Sequencing Primer
(F):5'- TCCAGAGGATATAGCAGGGAGAGC -3'
(R):5'- AGGGCGTTAATCCCCGGTG -3'
Posted On2015-04-06