Incidental Mutation 'R3840:Jhy'
ID277115
Institutional Source Beutler Lab
Gene Symbol Jhy
Ensembl Gene ENSMUSG00000032023
Gene Namejunctional cadherin complex regulator
Synonyms4931429I11Rik
MMRRC Submission 040780-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.029) question?
Stock #R3840 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location40894849-40964118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40944846 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 115 (E115V)
Ref Sequence ENSEMBL: ENSMUSP00000034521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034521]
Predicted Effect probably benign
Transcript: ENSMUST00000034521
AA Change: E115V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034521
Gene: ENSMUSG00000032023
AA Change: E115V

DomainStartEndE-ValueType
low complexity region 42 51 N/A INTRINSIC
low complexity region 71 85 N/A INTRINSIC
low complexity region 216 229 N/A INTRINSIC
low complexity region 383 398 N/A INTRINSIC
low complexity region 624 638 N/A INTRINSIC
Pfam:DUF4591 648 767 7.2e-38 PFAM
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit hydrocephalus, domed cranium, ataxia, weight loss, enlarged lateral ventricle, neuodegeneration, abnormal brain ependymal motile cilium and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik A T 18: 6,620,104 K11N probably benign Het
Abcc8 A G 7: 46,108,100 I1375T possibly damaging Het
Ate1 A T 7: 130,516,137 D39E probably damaging Het
BC035947 G T 1: 78,497,845 N683K probably benign Het
C530008M17Rik A T 5: 76,859,011 Q1073L unknown Het
Cdca2 A T 14: 67,680,271 Y559* probably null Het
Cmya5 A G 13: 93,094,632 V1316A probably damaging Het
Cntnap5b C T 1: 100,383,477 T936I possibly damaging Het
Col6a5 T C 9: 105,928,611 N1032S unknown Het
Elmsan1 T C 12: 84,171,609 R526G probably damaging Het
Epc2 A G 2: 49,488,738 K68R probably damaging Het
Erbb3 A T 10: 128,570,324 F1075I probably benign Het
F11r G T 1: 171,460,889 R100L probably damaging Het
Fam171b C A 2: 83,880,062 Q693K possibly damaging Het
Fam198b T A 3: 79,908,590 D302E probably benign Het
Fam83c C T 2: 155,834,748 R34H probably benign Het
Fmn2 GAAGA GAAGAAAGA 1: 174,582,033 probably null Het
Ggt1 T A 10: 75,581,385 Y5* probably null Het
Hsph1 T A 5: 149,620,715 probably null Het
Kcnu1 G T 8: 25,885,352 V365L possibly damaging Het
Lrrc4c A G 2: 97,630,192 T388A probably damaging Het
Mastl T C 2: 23,140,551 D202G probably damaging Het
Medag T A 5: 149,427,423 I121N probably damaging Het
Mocos C T 18: 24,676,624 A428V probably damaging Het
Mok C T 12: 110,815,157 V59M probably benign Het
Neb C A 2: 52,207,660 probably null Het
Nr2c2 C T 6: 92,163,138 R464W probably damaging Het
Olfr129 A G 17: 38,055,348 S73P probably damaging Het
Olfr593 G A 7: 103,212,693 G267R probably damaging Het
Otud1 G T 2: 19,658,743 E228* probably null Het
Pcdhga11 A T 18: 37,757,549 N537Y probably damaging Het
Pkd1l1 T C 11: 8,889,050 Y878C probably damaging Het
Podxl C T 6: 31,523,081 V485I probably damaging Het
Psmd12 T C 11: 107,485,572 I44T probably benign Het
Rap1gap T C 4: 137,717,447 F182S probably damaging Het
Slc22a13 T C 9: 119,208,789 D91G probably benign Het
Slc4a11 A G 2: 130,688,054 F268S probably damaging Het
Snap91 C T 9: 86,839,565 V74M probably damaging Het
Tmem87b T A 2: 128,826,384 L150* probably null Het
Tmprss7 T A 16: 45,660,832 R664* probably null Het
Tnfrsf11b T A 15: 54,252,082 H373L probably damaging Het
Tnfrsf23 A G 7: 143,681,529 S33P probably benign Het
Tro A G X: 150,646,202 probably benign Het
Tulp1 A G 17: 28,353,715 V489A probably damaging Het
Wac C A 18: 7,918,535 P416H probably damaging Het
Zap70 T A 1: 36,778,417 I247N probably damaging Het
Zfp617 G A 8: 71,932,117 G97E probably damaging Het
Other mutations in Jhy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Jhy APN 9 40922752 missense probably benign 0.00
IGL00784:Jhy APN 9 40922752 missense probably benign 0.00
IGL01370:Jhy APN 9 40917142 missense probably benign 0.00
IGL01433:Jhy APN 9 40917216 missense possibly damaging 0.58
IGL01618:Jhy APN 9 40960964 missense possibly damaging 0.88
IGL01981:Jhy APN 9 40895546 missense probably damaging 1.00
IGL02047:Jhy APN 9 40917180 missense probably benign 0.00
IGL02076:Jhy APN 9 40917378 nonsense probably null
IGL02093:Jhy APN 9 40944867 splice site probably null
IGL02177:Jhy APN 9 40898257 missense probably damaging 1.00
IGL02406:Jhy APN 9 40910989 missense probably damaging 1.00
IGL02548:Jhy APN 9 40917175 nonsense probably null
IGL02550:Jhy APN 9 40917170 missense probably benign 0.26
IGL02651:Jhy APN 9 40917335 missense probably damaging 1.00
IGL03080:Jhy APN 9 40944357 missense probably damaging 1.00
IGL03168:Jhy APN 9 40917552 missense possibly damaging 0.92
IGL03384:Jhy APN 9 40960932 missense probably benign 0.01
R0980:Jhy UTSW 9 40944837 missense possibly damaging 0.91
R1703:Jhy UTSW 9 40944837 missense probably damaging 1.00
R1711:Jhy UTSW 9 40911157 nonsense probably null
R1767:Jhy UTSW 9 40961148 missense probably benign 0.07
R2371:Jhy UTSW 9 40917482 missense probably benign 0.32
R2432:Jhy UTSW 9 40960886 missense probably benign 0.21
R3841:Jhy UTSW 9 40944846 missense probably benign 0.09
R4368:Jhy UTSW 9 40917144 missense possibly damaging 0.95
R4569:Jhy UTSW 9 40911093 missense probably benign
R4570:Jhy UTSW 9 40911093 missense probably benign
R4669:Jhy UTSW 9 40961153 missense probably benign 0.03
R4762:Jhy UTSW 9 40911198 missense probably benign
R4902:Jhy UTSW 9 40897525 intron probably benign
R4932:Jhy UTSW 9 40961003 missense possibly damaging 0.66
R5704:Jhy UTSW 9 40897438 missense probably damaging 0.99
R5890:Jhy UTSW 9 40922662 nonsense probably null
R6701:Jhy UTSW 9 40917591 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGTAAGGAGGCTTCGCTCTG -3'
(R):5'- CACCCTCACCAGCTAGATAGTG -3'

Sequencing Primer
(F):5'- AGGCTTCGCTCTGAGGACTC -3'
(R):5'- CCTCACCAGCTAGATAGTGAAAGG -3'
Posted On2015-04-06